1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
stiv31 [10]
2 years ago
5

A renewable resource is one that?

Biology
1 answer:
artcher [175]2 years ago
6 0

Answer:

That won't run out in our lifetime. It can replenish itself naturally.

Explanation:

You might be interested in
Answer please I will give points
Troyanec [42]

Answer:

A

//this msg was written as I needed more words//

6 0
3 years ago
Read 2 more answers
Scientist Year
jeka94

Answer:

I would say the answer is D.

Explanation:

It makes the most sense.

5 0
4 years ago
Read 2 more answers
Describe and explain the importance of the change to corn
Nutka1998 [239]

Answer:

As the world's most dominant and productive crop, with extensive areas of land dedicated to global production yields of over 1 billion metric tons, corn is used for a variety of purposes — including animal feed, grain for human consumption, ethanol, as well as for high fructose corn syrup, sweeteners, starch, and for ingredients in food and all natural products

6 0
3 years ago
Read 2 more answers
Discussion of the observations of an experiment of epidermal cell of onion bulb
marysya [2.9K]
Solution
Cut open an onion.
Use forceps to peel a thin layer of epidermis from the inside.
Lay the layer of epidermis on a microscope slide.
Add a drop of iodine solution to the layer.
Carefully place a coverslip over the layer.
Observe it under a microscope to see onion cells.
3 0
2 years ago
what is the sequence of mRNA codons that are synthesized during transcription that go with TACCGGATGCCAGATCAAATC, TACGGGGGCGTAAC
VLD [36.1K]

Answer:

Tfftfxggfddsd

Explanation:

Because of the condons

7 0
3 years ago
Other questions:
  • What is the carrying capacity of an ecosystem?
    6·1 answer
  • How can we represent the weather conditions on a station model?
    13·1 answer
  • The organelles and fluid in a cell together make up the __________.
    10·1 answer
  • In what plant structures does photosynthesis occur?
    6·1 answer
  • I need help with this question
    10·1 answer
  • Please help! Outline the structure of the main tissues of the body (skin and stomach) Write a brief description to show how diff
    14·1 answer
  • DOY CORONA SI ME AYUDAN PLSS<br> que fases de la mitosis de observan en la imagen.
    10·1 answer
  • Help guyz please please please
    7·1 answer
  • How do vaccines protect the human body systems from viruses?
    6·1 answer
  • Mutation occurs and the GGA coden is changed to GGA. What effect does the substitution have on the amnio acid?
    10·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!