1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Luda [366]
3 years ago
15

using your text, compare oxygen, sodium, nitrogen, and neon. which atom has the greatest capacity to gain electrons

Biology
1 answer:
Elden [556K]3 years ago
4 0
The atom with the greatest capacity to gain electron is OXYGEN. 
Oxygen has atomic number 8 and it has six electrons in its outermost shell. In order to attain octet structure, oxygen prefer to gain electron from other elements which have electrons which they can donate.<span />
You might be interested in
D. What would the world's population be in 500 years if there are Currently 7
ivanzaharov [21]
I need apjc what?? i dont get
7 0
3 years ago
The energy associated with an object's position is termed
Flauer [41]
The answer to this is mechanic energy. 
6 0
4 years ago
Why does animal viruses affect only animal but not to the plants?​
Vikentia [17]
Viruses belonging to (+) ssRNA Tymoviridae and Tenuivirus are able to infect invertebrates and plants [15]. There are some virus families that have diverse host ranges. The Reoviridae (dsRNA) family includes viruses that infect vertebrates, vertebrates and invertebrates, or plants and invertebrates.
8 0
3 years ago
Differentiate among a swamp and a marsh. Explain how they are similar and how
trapecia [35]
The difference between the two is that swamps usually have deeper standing water and are wet for longer periods of the year, according to the National Parks Service. Marshes have rich, waterlogged soils that support plant life, according to National Geographic.
Hope it is helpful
3 0
3 years ago
Describe five good reasons why we should not use GMOs?Support each reason with an example of GMOs used.
Vesna [10]
Here’s one! Huge farming companies genetically modified foods to withstand round up. You might know round up as a weed killer. It’s marketed safe with no harming chemicals to humans. That is completely wrong and have been proven to cause many chronic illnesses including cancer. These foods are modified to not react with round up and only to kill the weeds all around the plants. Even though the food looks ok it’s really not. The round up is all over the food. Then we eat it and well bad chemicals get absorbed into are body.

I hope this is some of what you were looking for. If not I hope you enjoyed my fun fact ;) good luck.
4 0
3 years ago
Other questions:
  • Carriers of the sickle-cell allele (i.e. those with a heterozygous genotype) are fittest in environments with high frequencies o
    6·1 answer
  • Create environmental slogans for your city or town.
    12·1 answer
  • The sequence of coding strand of a DNA molecule is given below. Assume that it is read from left to right. CCTACCTTATGCCAAGTTGGG
    15·1 answer
  • How do aquatic factors affect the distribution of aquatic life (include both biotic and abiotic factors)?”
    14·1 answer
  • 1. Based on the graph, make an inference about where the "community acquired" penicillin resistant S. aureus originated from.
    14·1 answer
  • In E. coli, there is a mutation in a gene called dnaB that alters the helicase that normally acts at the origin of replication.
    14·1 answer
  • The ability to replace the wildtype alleles with a knockout allele in mice has enabled researchers to carry out important revers
    9·1 answer
  • If someone adds thousands of small fish to a lake, how would the number of big fish<br> change?
    9·1 answer
  • According to the graph, which region's population is expected to approach 500 million in the year 2040?
    14·1 answer
  • Explain what is ecological conservation and conservation of the environment. What can you do to conserve the environment? Why do
    6·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!