1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Kazeer [188]
2 years ago
13

Subduction of ocean crust happens–

Biology
2 answers:
guajiro [1.7K]2 years ago
6 0
Option A: at a mid oceanic ridge
OverLord2011 [107]2 years ago
6 0
Option A is correct

hopes this helps
You might be interested in
A green plant absorbs a toxic substance that completely blocks the
hram777 [196]

Answer:

b

Explanation:

6 0
3 years ago
If an earthquake were to occur at Binghamton New York which location would experience seismic waves first
Ainat [17]
Brocklyn...............................................
5 0
3 years ago
Arteries are normally depicted as red while veins are colored blue due to the oxygenation of the blood being transported by each
Bogdan [553]
The exceptions to this rule are the pulmonary arteries and veins.  
<span>
The pulmonary artery is the one that carries deoxygenated blood from the right side of the heart (ventricle) to the lungs. On the other side, pulmonary veins transfer oxygenated blood from the lungs to the heart (left atrium).</span>
8 0
3 years ago
Many energy sources are renewable, but cost more to use than fossil fuels. <br> True or False?
mrs_skeptik [129]
True, but there are some energy sources cheap
7 0
4 years ago
Read 2 more answers
The desert and tundra are alike because they both have A) extreme daily temperature changes. B) large seasonal variation. C) lim
Ostrovityanka [42]
The desert and tundra are alike because they both have limited available water. 
4 0
3 years ago
Read 2 more answers
Other questions:
  • Which contains kerogen
    7·1 answer
  • The process by which complex molecules are broken down into simpler ones for the body's use is called
    13·1 answer
  • what season is occurring in earths northen hemisphere when earths southern hemisphere is tilted toward the sun
    13·1 answer
  • The cardiovascular system consists of
    8·1 answer
  • Paheli dug two pits, A and B, in her garden. In pit A, she put a polythene bag packed with some
    13·1 answer
  • HELP PLEASE 100 POINTS &amp; BRAINLIEST
    10·1 answer
  • Polarity is important because polar and nonpolar molecules have
    11·1 answer
  • The great white shark carchardon carcharias belongs to what genus?
    14·2 answers
  • What would be the complementary strand for the following DNA sequence 5' GACATACCCAGACGGTATATTGA 3'
    8·1 answer
  • The new plant produced by the technique of layering must remain attached to the stem of the original plant. True or false
    15·2 answers
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!