1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
kotegsom [21]
2 years ago
11

A 5 armor drake is crossed with a no armor drake. All of the offspring were 3 armor. Based on these results, which variation do

you think is dominant, 5 armor or no armor? Why?
Biology
2 answers:
wariber [46]2 years ago
6 0

Answer:

5 armor?

Explanation:

mina [271]2 years ago
6 0

Answer:

three Drake Scales

Explanation:

You might be interested in
What statement most completely describes the primary role of the cell in a multicellular organism?
qaws [65]
The answer for this problem is B
4 0
3 years ago
Why does the Ocean appear to be blue?
Oliga [24]

I do believe the answer is B

6 0
3 years ago
Read 2 more answers
How do you INCREASE kinetic energy?
xxMikexx [17]
Moving faster will increase the kinetic energy
5 0
3 years ago
Read 2 more answers
Select all the potential effects of damming a river.
bonufazy [111]

The answer is; C & E

Building a dam alters the water regime down the dam. The dam also affects fish migration along the river, alters the transportation of sediments by the river downstream, and changes temperatures within the local environment of the dam. These changes, however, the subtle effect the ecosystem around the dam and down the river. The potential energy of the water held by the dam is, however, high and used to produce more electricity.  

7 0
2 years ago
Translate the mRNA of the above (Question 2) transcription. ... 3' tcgccctactcgcgtacaccgcgtattgac 5' turns into:
Kryger [21]

agcgggaugagcgcauguggcgcauaacug
4 0
3 years ago
Other questions:
  • What are the function of roots? ​
    5·1 answer
  • PLEASE HURRY YOU WILL GET 99 POINTS explain how musculs are effected in space and what's inporten of international space
    8·2 answers
  • Name three examples of stimuli
    12·1 answer
  • A new object has been discovered in the solar system. In your own words, justify how the object can be proved to be a planet
    10·2 answers
  • The cell walls of plants and algae have openings, or channels. How is this structure most likely related to the functioning of a
    8·1 answer
  • Can the scientific method be used to prove unique historical events?
    6·1 answer
  • A poly A tail is added to the mature mRNA after transcription <br> True or false
    5·1 answer
  • 3
    13·1 answer
  • What is the visual acuity of the average human eye?
    5·1 answer
  • Please need answers quick Explain how soil composition is affected by environmental factors.
    13·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!