1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Arisa [49]
2 years ago
12

I NEEED THE ANSWER ASAP PLEASE What is the difference between a sound wave and a light wave? Select all that apply. A A sound wa

ve can travel in outer space. A light wave cannot travel in outer space. B A sound wave is a mechanical wave. A light wave is an electromagnetic wave. C A sound wave can travel in a vacuum. A light wave cannot travel in a vacuum. D A sound wave travels using charged particles. A light wave travels using a medium. E A sound wave needs a medium to travel. A light wave does not need a medium to travel. F A sound wave is considered a disturbance. A light wave is considered a periodic disturbance.
Biology
1 answer:
SSSSS [86.1K]2 years ago
7 0

Answer:

B

Explanation:

light can travel through space sound can't???

You might be interested in
According to the phylogenetic tree, which domains are more genetically related?
quester [9]

Answer: The correct answer is- Archaea and Eukarya.

As per the information about the (phylogenetic tree) given in the question,

the last branch of the phylogenetic tree begins with the line of Eukarya and then holds the species of the Archaea division, which includes those prokaryotic organisms that live in extremely harsh environmental conditions ( such as Methanobacterium, and extreme halophiles).  

As this last branch holds species of two domains ( from 3 domain system of classification that includes Bacteria, Archaea, and Eukarya) , which are Archaea and Eukarya as it begins with Eukarya and later on holds the species of Archaea.

Thus, it shows that Archaea and Eukarya are more genetically related.

3 0
3 years ago
The enzyme telomerase solves the problem of replication at the ends of linear chromosomes by which method?
adell [148]
<h2>Answer </h2>

The method is by adding various small DNA chains such as TTAGGG, that develop a hairpin turn.

<u>Explanation </u>

The method is by adding various small DNA chains such as TTAGGG, that develop a hairpin turn. Telomerase is an RNA dependent DNA polymerase means an enzyme that can make DNA using RNA as a template. The ends of linear chromosomes called telomeres that protect genes from getting deleted as cells continue to divide. The telomerase enzyme attaches to the end of chromosome complementary bases to RNA template are added on 3 ends of the DNA strand.

3 0
3 years ago
Compare and contrast primary and secondary succession
MissTica
Primary succession occurs in essentially lifeless areas while secondary succession happens where there were previous communities
7 0
2 years ago
_____________ growth occurs when the growth rate is proportional to the size of the population.
Rudiy27
Exponential is the missing word
5 0
2 years ago
Read 2 more answers
Decode CCGCTTTCGCTATTATAAAAAGGGCTATAACTA
Alla [95]

Answer:

GGCGAAAGCGAUAAUAUUUUUCCCGAUAUUGAU. I think sorry if I'm wrong

8 0
2 years ago
Other questions:
  • If you were spin a spinner numbered 1 - 10, what would is the probability of getting an odd number
    13·2 answers
  • How will you explain the sudden boost of energy, increased strength to lift very heavy objects during emergency situations
    15·2 answers
  • _____ is a gas giant, has the shortest day of all the planets, and has the largest moon in the solar system.
    6·2 answers
  • The process of making rna from dna
    13·1 answer
  • Carbon skeletons to be broken down during cellular respiration can be obtained from
    7·1 answer
  • Food is moved from the mouth to the stomach by what
    9·2 answers
  • WILL MARK BRIANLIEST!!! please help
    13·2 answers
  • Can someone help me ??
    12·1 answer
  • URGENTT
    12·1 answer
  • WATER CYCLE &amp; IT'S COMPONENTS
    5·2 answers
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!