1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
pshichka [43]
3 years ago
15

A species can develop genetic diversity ____

Biology
2 answers:
Lubov Fominskaja [6]3 years ago
5 0

Answer: The correct answer is-  C. over a long period of time.

Genetic diversity can be described as the sum of all the genetic characteristics, which correspond to the genetic makeup of all the organisms within a species.

Genetic diversity allows the organisms of a population to adapt to the changing environmental conditions as beneficial alleles allows the differential survival and reproduction of an organism.

Thus, a species  develop genetic diversity over a long period of time that brings desirable modification or lead to the evolution of new species.

Julli [10]3 years ago
5 0

The answer is c for this question

You might be interested in
When the continents are_, they receive less sunlight
likoan [24]
When the continents are at the Earths poles, they receive less sunlight.
4 0
3 years ago
White paper reflects all colors of the spectrum. It appears white under white light. It appears red under red light. Red paper o
soldier1979 [14.2K]
Red, both will be red, the red paper will absorb the white light and putt out red.
6 0
3 years ago
Read 2 more answers
I NEED THIS QUICK!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!
Pavel [41]

Answer:

PGA not sure But Ithink that the correct answer

Explanation:

3 0
3 years ago
_____ is the component in a cats eye that reflects light and helps with night vision.
kykrilka [37]
The part of their eye , located behind the retina ,called the Tapetum lucidum. It is reflective and helps the cat with night vision based on how light passes through it
7 0
3 years ago
2. Transcribe the following DNA segment 5’ agcgggatgagcgcatgtggcgcataactg3’ 3’ tcgccctactcgcgtacaccgcgtattgac5’ 3. Translate the
Ierofanga [76]
<span>3’ tcgccctactcgcgtacaccgcgtattgac 5’ </span>turns into:
5' agcgggaugagcgcauguggcgauaacug 3'

adenine becomes uracil hope this helped :)
6 0
3 years ago
Other questions:
  • Part a which of these phases encompasses all of the stages of mitosis but no other events?
    5·1 answer
  • The picture shows a contractile vacuole of a unicellular freshwater organism. The contractile vacuole regulates the flow of wate
    15·1 answer
  • Removal of a population can cause a population _______ in any of that species' competitors.
    11·1 answer
  • Period between two periods of mitosis
    6·1 answer
  • As you look at the general trends of the graph, what happens to the biodiversity when a mass extinction happens? Why?
    5·1 answer
  • How is mud activity's and making stuff from mud is science?? pls help plss
    12·1 answer
  • Which of the following is NOT TRUE about blood pressure?
    9·1 answer
  • Which two body systems are interacting in the diagram?
    11·1 answer
  • How much energy radiated by the sun resches the Earth?
    11·2 answers
  • I don’t wanna go to school I’m so tired
    15·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!