1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
kherson [118]
2 years ago
10

The diagram compares the sizes of the armadillo, a modern animal, and the glyptodont, an ancient animal that resembled an enlarg

ed armadillo.
The length of an armadillo is 0.5 m, and the length of the glyptodont is 3 m. The glyptodont is large and armored, but otherwise has a similar shape and body structure as the armadillo.

Which of the following statements is MOST STRONGLY supported by the evidence shown in the diagram?

A. Ancient animals were either larger or smaller examples of modern animals.
B. Ancient animals grew much larger than modern animals because of their environment.
C. Ancient animals were identical to modern animals, but fossil evidence can distort their traits.
D. Ancient animals resembled modern animals in some ways, but differed in other ways.
Biology
1 answer:
Andru [333]2 years ago
8 0

I think its D,

not sure though

You might be interested in
Anyone got any good chewy chocolate chip cookie recipes
nordsb [41]
No, but you can always turn to google, or ask a relative as they may be more experienced.
7 0
3 years ago
Importance of enviroment
natima [27]

Answer:

hope it's helps you and plz mark me brilliantest

Explanation:

environment plays an important role in the healthy living of human beings. it matters because it is the only home that humans have ,and it provides air, food and other needs. Humanity's entire life support system depends on the well -being of all the environment factors.

3 0
3 years ago
what is the significance of the demographic transition in studies of human population aroumd the world?
VMariaS [17]
State of demographic transition of all countries dictates the growth rate of global population and how close we are to carrying capacity
7 0
3 years ago
The thermosphere is the layer within the atmosphere where
swat32
It’s above the mesosphere, but below the exosphere. It extends roughly 90 km to 500/1,000 km above. There’s a lot of solar activity that influences temperature there.
4 0
4 years ago
The spherical object within a cell that controls its activity is the _____
Rus_ich [418]
The nucleus is a spherical object, and it controls cell activity.
3 0
3 years ago
Other questions:
  • In some cows, the genes for white and red hair are both dominant. A roan cow has both white and red hair. This is an example of
    14·2 answers
  • 3. Which is true about the light-independent reactions?
    7·1 answer
  • Why is the probability that an offspring will have round seeds 50%
    11·2 answers
  • Why is eating local food instead of food produced elsewhere often helpful to the environment?
    5·1 answer
  • Your body contains tens of thousands of different proteins, each with a specific structure and function. The unique three-dimens
    15·1 answer
  • How does sweating help to cool and regulate body temperature? A) The increased salt concentration of the body's cells helps main
    5·2 answers
  • TACTTAGAGGCACCACATGGGCCTTGCACT to mRNA
    12·1 answer
  • I’ll give points + brainalist (:
    13·2 answers
  • Which statement about cellular respiration is true?
    5·1 answer
  • Help me pleaseeeeeeeeeeeeeeeeeeee
    14·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!