1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Ne4ueva [31]
2 years ago
7

A population characterized by the largest number of people in the post-reproductive age group on a population pyramid will tend

to
Biology
1 answer:
SIZIF [17.4K]2 years ago
8 0

The number post-reproductive age group will decline in number in a population pyramid.

<h3>What is a population?</h3>

A population is a group of organisms of the same same specie living in a defined area of a given habitat.

A population pyramid shows the number of organisms of age groups in a population.

The post-productive age group is characterized by individuals that are too old to have children.

Since they are too old to have children, the post-reproductive age group will decline in number.

Learn more about population at: brainly.com/question/25896797

You might be interested in
A little help guys? Thanks.
Kobotan [32]
B. some species die out when environmental changes occur
8 0
2 years ago
Read 2 more answers
________ are the body's primary and most immediate source of energy. fats carbohydrates proteins
wariber [46]
Hello There!

Carbohydrates are the body's primary and most immediate source of energy. 

This is because carbohydrates are broken down by an enzyme called carbohydrase into glucose. Glucose is the immediate energy source.

Hope This Helps You!
Good Luck :) 

- Hannah ❤

3 0
3 years ago
In the 18th century, Carl Linnaeus published a system for classifying living things, which has been developed into the modern
Mazyrski [523]

Cavalier-Smith's model no longer separates prokaryotes and eukaryotes is the statement which differs from kingdom classification.

Explanation:

Cavalier-Smith in 1998 had reduced the kingdom numbers. The were brought down from 8 to 6. These are:

Animalia

Protozoa

fungi

plantae

chromista

bacteria

He divided eukaryotes into 6 kingdoms.  The kingdoms are refined for better classification.

While Carolus Linnaeus divided the organisms into two kingdoms

Animalia and plantae.

The five kingdom classification:

Monera (prpkaryotes)

Protista  ( unicellular eukaryotes)

fungi (multicellular decomposers)

plantae (multicellular producers)

Animalia (multicellular consumers)

It has drawbacks like in kingdom monera both autotrophs and heterotrophs  are included. Phylogeny is not explained in lower organisms of monera and protista. Virus is also in classification. Cavalier-Smith introduced a new kingdom called chromista which are single- celled or multicellular eukaryotic organisms as diatoms, algae, oomycetes and protozoans which perform photosynthesis.

6 0
3 years ago
Read 2 more answers
You are examining the phylogenic relationship of a newly discovered plant species (Species 2). You amplify the RUBISCO barcode a
frozen [14]

Answer:

a. Inversion

b. Duplication

Explanation:

Inversion has the name suggest, has to do with a segment of DNA being reversed from end to end.

In this case here,

Inversion is taking place here.

species 1 ATGCAAATTTGGGCCCATGAATGGTTGCAA

species 2 ATGCAAAAATTTTGGTACGCCGAATGGTTGCAA

Therefore, the sequences in bold in species 1 are observed to be reversed end to end in species 2.

Deletion ❌❌

I am sure it's not feasible because deletion entails removal of a few sequences.

It can be seen that species 2 is longer than species 1, which gives another reason why deletion is not feasible too, as no sequences are seen to be deleted.

I believe duplication is feasible since AATT sequences are repeated once.

Our final answer,

inversion and duplication occur here.

4 0
3 years ago
Passwords, tokens, and fingerprint scans are all examples of ________. identification authentication authorization credentials
julia-pushkina [17]
The answer to the fill in the blank is option B) Authentication


Passwords, tokens, and fingerprint scans are all examples of Authentication.

We use passwords, tokens and even fingerprints since they can be unique identifications and are usually seen as more secure.

In the above options, fingerprints are seen as the most secure form of authentication since everyone has unique fingerprints.

One of the earliest forms of authentication were time cards used as early as the 1950s and even unique keys and stamps used by early civilizations.


5 0
3 years ago
Other questions:
  • Streptococcus pneumoniae can escape phagocytic clearance by which mechanism
    6·1 answer
  • How can independent assortment and crossing over occur during meiosis
    7·1 answer
  • A leaf falls from a tree and lands on the sidewalk. Identify an action-reaction pair in this situation.
    11·1 answer
  • How is carbon stored in the biosphere?
    12·1 answer
  • One way that fossils form by the dead organism's soft tissue is
    5·1 answer
  • Humans often selectively breed plants to create better, more nutritious crops. Plants are not as difficult to selectively breed
    6·1 answer
  • A gene for corn has two alleles, one for yellow kernels and one for white kernels. A farmer mates yellow and white corn. All of
    11·1 answer
  • Is a goose a primary or secondary consumer?
    13·1 answer
  • ___________ control all chemical reactions including metabolic processes like photosynthesis and cellular respiration
    10·1 answer
  • Briefly explain how sexual reproduction generates new allele combinations in offspring.
    11·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!