B. some species die out when environmental changes occur
Hello There!
Carbohydrates are the body's primary and most immediate source of energy.
This is because carbohydrates are broken down by an enzyme called carbohydrase into glucose. Glucose is the immediate energy source.
Hope This Helps You!
Good Luck :)
- Hannah ❤
Cavalier-Smith's model no longer separates prokaryotes and eukaryotes is the statement which differs from kingdom classification.
Explanation:
Cavalier-Smith in 1998 had reduced the kingdom numbers. The were brought down from 8 to 6. These are:
Animalia
Protozoa
fungi
plantae
chromista
bacteria
He divided eukaryotes into 6 kingdoms. The kingdoms are refined for better classification.
While Carolus Linnaeus divided the organisms into two kingdoms
Animalia and plantae.
The five kingdom classification:
Monera (prpkaryotes)
Protista ( unicellular eukaryotes)
fungi (multicellular decomposers)
plantae (multicellular producers)
Animalia (multicellular consumers)
It has drawbacks like in kingdom monera both autotrophs and heterotrophs are included. Phylogeny is not explained in lower organisms of monera and protista. Virus is also in classification. Cavalier-Smith introduced a new kingdom called chromista which are single- celled or multicellular eukaryotic organisms as diatoms, algae, oomycetes and protozoans which perform photosynthesis.
Answer:
a. Inversion
b. Duplication
Explanation:
Inversion has the name suggest, has to do with a segment of DNA being reversed from end to end.
In this case here,
Inversion is taking place here.
species 1 ATGCAAATTTGGGCCCATGAATGGTTGCAA
species 2 ATGCAAAAATTTTGGTACGCCGAATGGTTGCAA
Therefore, the sequences in bold in species 1 are observed to be reversed end to end in species 2.
Deletion ❌❌
I am sure it's not feasible because deletion entails removal of a few sequences.
It can be seen that species 2 is longer than species 1, which gives another reason why deletion is not feasible too, as no sequences are seen to be deleted.
I believe duplication is feasible since AATT sequences are repeated once.
Our final answer,
inversion and duplication occur here.
The answer to the fill in the blank is option B) Authentication
Passwords, tokens, and fingerprint scans are all examples of Authentication.
We use passwords, tokens and even fingerprints since they can be unique identifications and are usually seen as more secure.
In the above options, fingerprints are seen as the most secure form of authentication since everyone has unique fingerprints.
One of the earliest forms of authentication were time cards used as early as the 1950s and even unique keys and stamps used by early civilizations.
