1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Gnom [1K]
3 years ago
5

When adaption is most likely to help a catus survive in the dry climate?

Biology
1 answer:
Elanso [62]3 years ago
6 0

Answer:

main ng sardines taco pre

You might be interested in
Pea Plants reproduce very quickly. In one or two growing seasons, Mendel was able to produce hundreds of offspring. How did this
quester [9]
Maybe comparing the different traits that the pea plants had such as height.
6 0
4 years ago
Look around you. Observe and list five (5) chemical changes that occur in all forms of matter.​
stira [4]
  • cooking an egg
  • burning wood
  • digesting food
  • baking cake
  • rusting of iron
  • hope it helps....

4 0
3 years ago
How does mutation enable viruses to continue causing disease?
Hunter-Best [27]
Genetic Change in Viruses. Viruses are continuously changing as a result of genetic selection. They undergo subtle genetic changes through mutation and major genetic changes through recombination. Mutation occurs when an error is incorporated in the viral genome
3 0
3 years ago
1.
MAVERICK [17]

Answer:

1. Purines

2. States that DNA composition varies among species

3. Hydrogen Bond

4. Purines

<em>Answer to #2 is a little iffy </em>-- sorry

Explanation:

Pyrmidines have two rings

Purines have one ring

Complementary bases are connected by hydrogen bonds.

4 0
4 years ago
Which of the following is correct for the effect of linkage on recombination?
USPshnik [31]
The one that is correct for the effect of linkage on recombination is : C. It reduces the percentage of recombination
In linkage on recombination it only use part of the Recombination that doesn't exist on the parent. Doesn't necessarily have to be 50 %

hope this helps
4 0
3 years ago
Read 2 more answers
Other questions:
  • Which object is smaller than a cell
    7·2 answers
  • How can scientists use cladograms to place new species that have been discovered?
    9·1 answer
  • Small, accessory chromosomes found in bacteria that are useful in recombinant dna procedures are called
    13·1 answer
  • What would be the complementary strand for the following DNA sequence 5' GACATACCCAGACGGTATATTGA 3'
    8·1 answer
  • Which location would benefit best from the use of solar panels?
    12·2 answers
  • Contrast common attitudes to bogs in the past and the present.
    13·2 answers
  • Which factors are involved in earthquake formation? Select three options. helppppp
    11·1 answer
  • 9. Gravity and other forces affect movement within an
    12·1 answer
  • 19. Dax just completed a report on car transportation. He concluded that gasoline
    12·2 answers
  • Describe the main structural features of the epidermis and explain the functional significance of each.
    14·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!