1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Feliz [49]
3 years ago
6

What are the Importance of sphingomyelin​

Biology
1 answer:
Maslowich3 years ago
5 0

Explanation:

sphingomyelin is a important part of cell creation.

  • This hormone usually collects exoplasmic leaflets from the cell and plants them near cell membrane.
  • Which further helps in creating a strong border
You might be interested in
What type of earthquake wave can travel through both liquids and solids? a. P waves b. S waves c. focus waves d. surface waves
Vinil7 [7]
Your answer is a. P waves                                                                                                                
8 0
3 years ago
Read 2 more answers
Which of the following statements is true about viruses?
Akimi4 [234]

Explanation:

viruses may contain very small cells viruses can produce them quickly when they get a mode of transmission viruses have hyphae BUT viruses never eat any food so second statement is true....

4 0
3 years ago
How does a pH of 3 differ from pH of 4? Which one is stronger or weaker? By How much?
NISA [10]
The difference between pH 3 and pH 4 is a 10 fold difference in the concentration of H+
6 0
3 years ago
As conditions change inside and outside the cell, the cell must adjust to maintain a stable internal environment. Which of the f
Svetllana [295]

B. The nucleus contains all the genetic information of the cell

3 0
4 years ago
Name the 4 Base molecules that link together to form DNA?
ArbitrLikvidat [17]

Answer:

adenine, thymine, cytosine and guanine?

Explanation:

3 0
3 years ago
Read 2 more answers
Other questions:
  • How do bacteria maintain their internal ph despite the ph of the environment in which they grow?
    11·1 answer
  • In a biome, what term refers to the natural supply of water in the form of rain?
    14·2 answers
  • Which observation describes an increase in the interrelatedness of the global economy?
    7·2 answers
  • What is an example of active immunity?
    13·1 answer
  • Imagine that scientists have discovered annelid life on a new planet. Remarkably, these worms are large in size, lack mouths, an
    7·1 answer
  • ¿Es la ciencia que estudia los mecanismos y dinámicas relacionada con los genes?
    8·1 answer
  • Question on picture for biology
    7·2 answers
  • Why do individuals with recessive
    14·1 answer
  • Which is a possible outcome of global warming?
    13·2 answers
  • Write the code for RNA from this DNA STRAND :<br><br> AAAAAATTTTTTCCCGGGGTTTATATATC
    15·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!