<span>A few examples of reptiles are alligators, crocodiles, turtles, and snakes. </span>A few examples of amphibians are <span>salamanders, toads, and frogs. One difference between the two is the structure of their outer skin. </span>Reptiles<span> are covered with scales, shields, or plates, and their toes have claws.</span>
Solar energy, wind energy, hydropower, geothermal energy, and biomass energy. These types of energy sources are different from fossil fuels, such as coal, oil, and natural gas.
Answer: Option A
Explanation:
The correct statement is that the there is a difference in protein which is found in the outer membrane and inner membrane of the mitochondria.
The inner membrane of the mitochondria is folded to allow maximum surface area for the energy production.
The inner part of the mitochondria contains the enzyme ATPase for energy production.
The outer membrane of the mitochondria contains enzymes for the export and import of the various materials with the help of TOM40 complex and TIM23 complex.
Answer:
If he inherited a mutation which made him more susceptible to lung cancer, it may have been present in some of the gametes he produced and passed to his children
Explanation:
Even tho the cause of lung cancer is not very clear, a genetic predisposition is of a great influence, his smoking and therefore causing a lung cancer is not appliable to his children because of no connection, but in the sense of having a mutation which makes you predisposable to the cancer with or without the smoking, can lead to a high risk of gene inheritance and therefore inheriting the mutation with a high risk of getting lung cancer excluding the smoking.
Full question attached
Answer/ Explanation:
The original DNA sequence has a point mutation changing a G to a T. The resulting mRNA produced is always complementary to the DNA from which it is synthesised, so the original mRNA sequence has a T, whereas the mutated mRNA has a U. The tRNA is complementary to the mRNA, so the original has a G, and the mutated has a T.
<h3>Original DNA</h3>
GTTGGCGAATGAACGGAGGCTGACGTCTAAGCCTAGAAAAATTGG
RNA
CAACCGCUUACUUGCCUCCGACUGCAGAUUCGGAUCUUUUUAACC
tRNA
GUUGGCGAAUGAACGGAGGCUGACGUCUAAGCCUAGAAAAAUUGG
<h3>_______________________________________________</h3><h3>Mutated DNA</h3>
GTTGGCGAATGAACTGAGGCTGACGTCTAAGCCTAGAAAAATTGG
RNA
CAACCGCUUACUUGUCUCCGACUGCAGAUUCGGAUCUUUUUAACC
tRNA
GUUGGCGAAUGAACTGAGGCUGACGUCUAAGCCUAGAAAAAUUGG
This is a point mutation called a substitution. This does not affect the entire sequence of the protein, because the mutation is "in frame" meaning the mRNA sequence is still read in the same way by the protein producing machinery. However, it does change the 5th codon from UGC to UGU. If we look up the genetic code, we can see that both of these codons code for cysteine, so there will be no change in the amino acid sequence of the protein
