1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
EastWind [94]
2 years ago
13

Which of these statements about Earth’s magnetic poles is NOT correct?

Biology
2 answers:
pav-90 [236]2 years ago
5 0

Answer:

The magnetic poles are located at the geographic north and south poles IS THE INCORRECT ANSWER

Ivenika [448]2 years ago
3 0

Its Option 1 : The earth magnetic field is primarily a dipole that is ithas two poles. This brings the North and south magnetic pole.

You might be interested in
PLEASE HELP DUE SOON 40 POINTS!
erma4kov [3.2K]

Answer:

earth's atmosphere

Explanation:

7 0
3 years ago
Which order do this go in? 60 points.
Murrr4er [49]

Answer: I got it :)

Explanation:

Domain, Kingdom, phylum, class, order, family, genus, and species.

6 0
3 years ago
Read 2 more answers
Which the following statements typifies tropical rain forests? A. They are usually composed of at least ten distinct layers, or
Novosadov [1.4K]

        The right answer here is option C. They occur in areas with ancient, mineral-poor soil.

         An example of that is Amazonia in Brazil, it's one of the biggest forests on earth, and at the same time, we know its soil is poor, but at the same time it has some special materials that can be found there, such as niobium. This forest is, too, rainy almost all the time, and this many trees maintain the temperature of the whole earth stabilized. These kinds of forests can grow in this soil because of the burlap, that's organic materials from its own trees. It's consumed by them, and through this way, it survives and extends its size when humans don't use its resources too much.

6 0
3 years ago
Translate the mRNA of the above (Question 2) transcription. ... 3' tcgccctactcgcgtacaccgcgtattgac 5' turns into:
Kryger [21]

agcgggaugagcgcauguggcgcauaacug
4 0
3 years ago
While mutation is random, natural selection is not. In your own words, explain how this is possible
alina1380 [7]

Answer:

Mutation is a alteration in the DNA sequence in a gene during cell divison iwhere gene is coded mitakeny or due to the error. Mutatio is a random process as it can not be determind or known befor bthechange in sequence what gene or DNA would be effected by it or what genes would be transfer from the parents.

Natural selection is a process where some of the traits that are helpful in the surviving and increasing the number of individuals in a population and transfer from one generation to other according the adaption and change over the long timeline. Thus, it is not random and based on the traits that are helpful in a environment or for the survival of  

3 0
2 years ago
Other questions:
  • An african american couple is undergoing genetic counseling to determine the likelihood of producing children with a recessively
    9·1 answer
  • What is meant by the phrase "Genetic Code"?​
    10·2 answers
  • Which of these facts about wild boars is best supported by the evidence provided? Wild boars were brought to the United States b
    10·1 answer
  • Jolene's friends are using weight-loss supplements to lose a lot of weight in a short amount of time. Jolene didn't think it was
    14·1 answer
  • True or false? The fastest land animal in the world is the zebra.
    14·2 answers
  • When hiv (the human immunodeficiency virus) infects a cell,it inserts a DNA copy of its genetic material into the host cell's ge
    7·1 answer
  • Methane is a(n) gas. Excess of methane in the atmosphere will lead to .
    14·1 answer
  • As the skin ages, it loses its ability to restore its shape due to a:
    5·1 answer
  • So why do cats have tails
    8·1 answer
  • Choose all the answers that apply.
    12·2 answers
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!