1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
-Dominant- [34]
2 years ago
13

12. Your body normally maintains a temperature of 98.6°F. This is an example of what?

Biology
1 answer:
Dmitrij [34]2 years ago
4 0

Answer: This is an example of Homeostasis!! :D

Explanation:

You might be interested in
Which of the following best depicts energy flow in an ecosystem?
Molodets [167]
Food chain and food web both depict the energy flow within the ecosystem because it is about animals Eating each other and thus transferring energy
7 0
3 years ago
What type of evolutionary mechanism did this story show?
Galina-37 [17]

Allele frequencies in a population may change due to four fundamental forces of evolution: Natural Selection, Genetic Drift, Mutations and Gene Flow. Mutations are the ultimate source of new alleles in a gene pool. Two of the most relevant mechanisms of evolutionary change are: Natural Selection and Genetic Drift.

6 0
2 years ago
Predict what changes might occur if DNA is altered in a particular organism.
pishuonlain [190]

Answer:

Explanation:

If the DNA codons are altered in an organism, the genetic code will be inaccurate. This will result in genetic mutations and disorders, depending on how drastic the change was. The two types of mutations are point mutations, that just replace one nucleotide. There's also frame shift mutations, where the amount of codons are incorrect.

6 0
2 years ago
Which of the following scientists made major contributions to cell theory?
docker41 [41]

Answer:

Schleiden, Schwann, and Virchow are the 3 major contributors to the cell theory.

8 0
2 years ago
PLEASE ANSWER
Lilit [14]

Answer:

D: Some traits in certain embryos disappear as the embryo develops.

Explanation:

Please tell me if I'm wrong

8 0
2 years ago
Other questions:
  • In your own words, describe chromosomes, genes, and DNA.
    12·1 answer
  • Why did Copernicus not tell anyone about his theory until his deathbed?
    6·1 answer
  • Name the two general categories that the study of science can be divided into
    7·1 answer
  • .Sea and land breezes over a large region that change direction with the season are called _____.
    5·1 answer
  • Match the macromolecules to their examples.
    11·2 answers
  • What would be the complementary strand for the following DNA sequence 5' GACATACCCAGACGGTATATTGA 3'
    8·1 answer
  • Albinismisar are genetic condition that inhibits the production of melanin,or pigmentation,in the skin and hair. People born wit
    8·1 answer
  • What is the symptom of marasmus disease<br>pls tell any 2 symptom of it <br>in short pls ​
    5·2 answers
  • Please ans this question.
    7·1 answer
  • For each statement,select the correct type of classification from the drop-down menu classification is based on the similar appe
    13·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!