1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
ki77a [65]
2 years ago
11

Which characteristics do all Protista have in common?

Biology
1 answer:
Anton [14]2 years ago
3 0

Answer:

c is my answer and it the right one

You might be interested in
Which is an example of population density?
Rudik [331]

Answer:

D: two jaguars per thousand hectares.

Explanation:

Population density refers to the computation of population by unit area. It is usually implemented in living organisms, generally in humans. It is a key geological term. In easy form, population density implies to the number of people existing in an area per square kilometer or hectare, etc.

So, two jaguars per thousand hectares is an example of population density as it involves the number of jaguars (population) per thousand hectares (per unit area).

8 0
3 years ago
Why are instant data, such as the number of rabbits in a field at one time, not usually as reliable as long-term data, such as t
otez555 [7]
D.) people may disagree in their interpretations of instant data.
3 0
4 years ago
Sandra has been having pains just under her diaphragm and a little to the right of the center of her body. They seem to be espec
kirill115 [55]
Hi.

She should ask her to doctor to investigate for Atherosclerosis. This typically happens when you eat foods high in Trans Fats.

5 0
3 years ago
Read 2 more answers
A piece of steel has a mass of 1170g and a volume of 150 cm3. What is the density of<br> steel?*
julsineya [31]

Answer:

<h3>The answer is 7.80 g/cm³</h3>

Explanation:

The density of a substance can be found by using the formula

density =  \frac{mass}{volume} \\

From the question

mass of metal = 1170 g

volume = 150 cm³

We have

density  =  \frac{1170}{150}  =  \frac{117}{15}   =  \frac{39}{5}  \\

We have the final answer as

<h3>7.80 g/cm³</h3>

Hope this helps you

6 0
4 years ago
What is the mRNA in TACCGGATGCCAGATCAAATC?
Softa [21]

Answer:

AUGGCCUACGGUCUAGUUUAG

3 0
3 years ago
Other questions:
  • Somatic cells of roundworms have four individual chromosomes per cell. How many chromosomes would you expect to find in a gamete
    7·1 answer
  • Which best describes how the fossil record supports the theory of evolution? The fossil record shows exactly how all species hav
    14·2 answers
  • DNA is a nucleic Acid that is responsible for both our genotype and our phenotype. Which of the following is the building block
    15·1 answer
  • Beginning in the 1600's, the human population on Earth:
    5·1 answer
  • How does the circulatory system work with the respiratory system?
    9·1 answer
  • Summarize how the founders effect and a bottleneck event would contribute to genetic drift
    11·2 answers
  • Which of the following is not produced by the Krebs cycle? NADH CO2 O2 FADH2
    12·1 answer
  • How does lymph return to the circulatory system from the lymphatic system? (2 points)
    10·2 answers
  • Gracias a la nutrición los seres vivos logran:
    14·1 answer
  • Give two reasons why it is important to conserve south Africa's plants and animals​
    9·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!