1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
BigorU [14]
2 years ago
14

Environmental resistance includes biotic/abiotic factors that are to life.

Biology
1 answer:
Arturiano [62]2 years ago
7 0

Answer:

The environmental resistance factors are all the factors or things that keep a population of the organisms from endlessly increasing i.e. keep a check on it. . They reduce the chances for reproduction, affect the health of organisms/individuals, and raise the death rate in the population.

The environmental resistance factors include the factors that are biotic and abiotic.

• The biotic factors are things like a predation, a parasitism, lack of food, competition with other organisms and disease.

• Abiotic factors include factors like drought, fire, temperature, and even the wrong amount of sunlight could affect it.

You might be interested in
Why do we need to follow the manual handling procedures and techniques?​
vova2212 [387]
Because it’s necessary
4 0
3 years ago
Which pattern of inheritance would explain the different fur color in the related dogs?
djverab [1.8K]

Answer:

B/b alleles.

from a presentation

6 0
2 years ago
Some people have low levels of calcium circulating in the blood, a condition known as hypocalcemia. While for many this disorder
antiseptic1488 [7]
Low levels can cause heart problems.
4 0
3 years ago
Rabbit stimulus environment
Sever21 [200]
Orienting Response, Freeze Response, Flight Response, Hiding Response, and the Fight Response.
7 0
3 years ago
A scientific study looked at the effect of tanning beds on DNA damage. The scientists took skin cells and exposed them to UV rad
forsale [732]

Answer:

Tanning of DNA using UV light at different time (1 minutes, 15 minutes, and 30 minutes)

Explanation:

Independent variable is the variable that was controlled or change and in this case it is the tanning of DNA with UV light at different times and the dependent variable is what is measured or the effect of the change in the independent variable which is DNA damage and the control was the cells that did not receive the treatment.

8 0
3 years ago
Other questions:
  • It is estimated that half of all conceptions have too many or too few chromosomes. According to the text, what happens to most o
    7·1 answer
  • Having free earlobes (F) is a dominant trait in humans, and having attached earlobes (f) is Recessive. A Father has the genotype
    8·1 answer
  • Looking through a microscope, you see a cell forming a cell plate during cytokinesis. Which cell are you looking at?
    10·1 answer
  • Why do you think the acceleration due to gravity is represented by a negative number?<br> 20 points
    13·2 answers
  • Which organism causes schistosomiasis?<br> A a worm<br> B a bacterium<br> C a virus<br> D a mosquito
    8·1 answer
  • During an investigation into muscle strength, a group of students planned to compare their bicep muscles. Each student planned t
    15·1 answer
  • What is the complementary DNA of TACCGGATGCCAGATCAAATC?
    10·1 answer
  • Which statement is incorrect about the adult human heart?
    14·1 answer
  • Someone help me please I’ll make brainlist!! Quick fast
    12·1 answer
  • How do false killer whales help mankind and nature!!!!!???????
    5·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!