Answer:
"GATGACATGGCGTCAGTCGATGCG" is the complete DNA sequence having 24 bases.
Explanation:
The shotgun sequencing is the process that is being used haphazard DNA strands arrangement. The nomenclature is given by the correspondence as it is growing rapidly. The pattern of firing is quasi accidental. In the preparation of DNA strands like 100 to 1000 base pairs, the chain alteration process is used. It can haphazardly break any DNA arrangement into many small pieces,and then can make copies that are completely identical to it.
Answer:
algae are autotrophs, and fungi are heterotrophs. algae contain photosynthetic pigments. fungi are capable of digesting non-living, organic material, and also absorbs simple nutrients by the fungal hyphae
Life forms that depend on remineralize shells and skeletons will be harmed by ocean chemistry, as would species that are acid-sensitive and organisms higher in the food chain that eat these sensitive animals.
<h3>An organism is what, then?</h3>
An organism is a collection of molecules working together to form an more or less permanent together that demonstrates the characteristics of life. Definitions in dictionaries frequently use general terms like "any biological entity, such as a plant or animal reproduction."
<h3>What two kinds of organisms are there?</h3>
Prokaryotic and eukaryotic organisms are the two primary categories. These type the cells that form the organism are the basis for this differentiation. Prokaryotic cells have a very basic, rudimentary structure without a nucleus. Additionally, membrane-bound organelles are absent.
To know more about organism visit:
brainly.com/question/13278945
#SPJ4
