1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Yuliya22 [10]
2 years ago
11

What is meant by wildlife? How is wildlife important for us?​

Biology
2 answers:
r-ruslan [8.4K]2 years ago
7 0

Answer:

Wildlife traditionally refers to undomesticated animal species, but has come to include all organisms that grow or live wild in an area without being introduced by humans. Wildlife maintains balance in ecosystems. Diversity means healthier ecosystems. and Ect

Explanation:

hope this helps

have an awesome day -TJ

SVETLANKA909090 [29]2 years ago
5 0

Answer:

Animals that grow or live in the wild without any human interference are known as wildlife. Importance of wildlife is as follows: Wildlife helps keep the food chain in place and thereby maintain ecological stability.

Explanation:

You might be interested in
Please put in order from smallest to largest (PLEASE HELP IM CRYING!!!!) ​
GarryVolchara [31]
I believe it is atom, then tree seedlings, then a cat, then a fence panel, then a pecan tree and lastly the house
8 0
3 years ago
Hewo can you help me with this?
Nutka1998 [239]

Answer:

A. Metabolism

Explanation:

Metabolism is the chemical reactions in the body's cells that change food into energy. Our bodies need this energy to do everything from moving to thinking to growing. Specific proteins in the body control the chemical reactions of metabolism.

8 0
3 years ago
Can someone please answer 15-17
yan [13]

Answer:

15. D have specific gened activated

16. G cell division is unregulated

17. D providing information to form proteins

Explanation:

15. When an egg is first fertilised, the cells are very flexible. They are sort of like a "blank slate", and can become any type of cell. From these cells, all the cells in the body are created: brain cells, skin cells, blood cells etc. To become all these different types of cells, they keep dividing, slowly branching off and becoming more specific. This process is called differentiation.

They do this because different patterns and combinations genes are activated that turn them in to these different and specific cell types.

16. One of the hallmarks of a cancer cell is unregulated cell division. Oncogenes start as normal genes (called proto-oncogenes) that function in normal processes, such as the cell cycle, inhibiting apoptosis. However, when they become mutated, they can promote the growth and division of cells and prevent their programmed death. This is because they become more active or present in higher amounts following the mutation. This causes such functions in the cell to become deregulated, leading to uncontrolled cell proliferation and the growth of harmful tumour cells.

17. The central dogma of biology states that DNA --> RNA --> protein. The messenger RNA (mRNA) is transcribed from the DNA. It contains a message that is translated by the protein synthesis machinery to form proteins.

This is how all the proteins in the cell are produced, and the information for how to encode them is entirely dependent upon the sequence of the DNA, which is sent as a coded message in the form of RNA, to the protein synthesis machinery. The protein synthesis machinery makes the proteins according to the DNA sequence (as translated from the mRNA).

3 0
3 years ago
LAST QUESTION!!!!AND LAST TRY!!!!!!! SHARE YO SMARTNESS!!!!!WILL GIVE BRAINLIEST!!!!!! RATE AND VOTE!!
Rasek [7]

Answer:

A.

Explanation:

Ecological succession is the process of change in the species structure of an ecological community over time. It is a phenomenon or process by which an ecological community undergoes more or less orderly and predictable changes following a disturbance of a new habitat.

3 0
3 years ago
Which term do biologists use to describe the number of individuals a species requires to reproduce successfully and prevent it f
In-s [12.5K]
Minimal viable population, it's the least population an ecosystem can have of a species and not go through catastrophic events.
8 0
3 years ago
Read 2 more answers
Other questions:
  • How is the Emergency Operations Center (EOC) interconnected with the other NIMS Command and Command and Coordination structures?
    5·1 answer
  • Describe what is required for the synthesis of :
    6·1 answer
  • Area where an oceanic plate goes down into the mantle
    8·1 answer
  • Without a cuticle, a plant _____.
    10·2 answers
  • Base Sequence of Complementary DNA Strands One strand of a double-helical DNA has the sequence (59)GCGCAATATTTCTCAAAATATTGCGC(39
    6·1 answer
  • A fruit fly has a recessive allele for no eyes (e). Two heterozygous fruit flies with eyes are crossed. What is the total number
    5·1 answer
  • Can I get some homework help?<br><br> Thanks to anyone who finishes it
    13·1 answer
  • Reading about plate tectonics​
    13·2 answers
  • Nitrogen dioxide is a gas that can be generated by emissions from vehicles and factories. It can also be generated by natural so
    12·1 answer
  • Genetic heterogeneity of amyotrophic lateral sclerosis: Implications for clinical practice and research.
    7·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!