1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Nana76 [90]
3 years ago
12

Which principle of heat exchange is the most important explanation for why birds look larger in colder weather because they fluf

f their feathers?.
Biology
1 answer:
kotegsom [21]3 years ago
5 0
Fluffing creates a pocket of air near the bird that acts as insulation.
You might be interested in
what is the geocentric model (please give simple answer and this is for my notes so there is no choices to pick from)
Margarita [4]
Any theory that the structure of the solar system in which earth is assumed to the centre of it all.

hope this helps <3
5 0
2 years ago
Read 2 more answers
Put in order from least complex (1) to most complex (4). atom, organ,tissue,cell
Kryger [21]
Atom, cell, tissue, organ
5 0
3 years ago
He variability in marine salinity between habitats does not impact the fish living there.
inysia [295]

Answer:

Sorry, you didnt add the question, I would have helped!

Explanation:

6 0
3 years ago
Which of the following does the endocrine system regulate?
Ivahew [28]

Answer:

Hormones

Explanation:

5 0
3 years ago
Which is the correctly balanced equation for the reaction of rust, Fe2O3, and hydrochloric acid, HCl?
Natalka [10]
Fe2O3 + 6HCl -> 2FeCl3 + 3 H2O

If you count the number of each elements on both sides, they are equal. If you need me to explain this better, let me know and I would be glad to help
4 0
3 years ago
Read 2 more answers
Other questions:
  • During the rainy season, and just as the dry season starts, food is abundant for all finches. However, as the dry season wears o
    5·1 answer
  • What is common to both prokaryotic and eukaryotic cell division?
    13·1 answer
  • Describe the three major sources of energy that power earth's environmental systems
    8·2 answers
  • How do I use a codon wheel to solve this sequence of DNA?<br><br> AGTACCCGTTAATTAGTTGCCG
    5·1 answer
  • Explain why the type of energy is different for photosynthesis and respiration.
    6·1 answer
  • Both mitosis and meiosis begin with a diploid cell that contains replicated chromosomes. Explain the main differences between th
    14·1 answer
  • Which aerobic processes takes place in mitochondria ​
    13·2 answers
  • PLEASE HELP!!!!!!
    12·1 answer
  • When a body dies, the decomposition process is __.
    15·1 answer
  • Describe the position of the frog when it is floating
    6·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!