1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Lynna [10]
2 years ago
15

Find the mean, median, and mode of the following list of values. Round to the nearest tenth if necessary.

Biology
1 answer:
grin007 [14]2 years ago
3 0

Answer:

<u>D. </u>

<u>Mean: 24.8</u>

<u>Median: 26</u>

<u>Mode: 26</u>

Explanation:

The mean is the average. To find the average, add up all the numbers and divide by the amount of numbers there are.

30 + 26 + 25 + 11 + 34 + 20 + 26 + 26 = 198

Now, we divide by how many numbers we started out with (8).

198 divided by 8 = 24.75, rounded would be 24.8

To find the median, you arrange the numbers from smallest to largest, and find the middle number like this:

11, 20, 25, 26, 26, 26, 30, 34

As you can see, the middle number is 26.

To find the mode, you arrange the number from smallest to largest, and find the number that appears more often.

11, 20, 25, 26, 26, 26, 30, 34

As you can see, the number 26 appears the most often.

So, we end up with:

<u>Mean: 24.8</u>

<u>Median: 26</u>

<u>Mode: 26</u>

<u></u>

<u></u>

<u></u>

:)

You might be interested in
3. How is heat transferred within the Earth?
drek231 [11]

Answer:

a and b Heat is transferred to the surface of the Earth from the hot Earth's core by conduction and from radiation from the Sun

Explanation:

if u can only pick one its b

7 0
2 years ago
Read 2 more answers
Mixtures are very different from compounds. Mixtures can be physically separated into different components and compounds cannot
rosijanka [135]
B is not a mixture and thx el the asnwer
6 0
3 years ago
Read 2 more answers
Explain how the MRNA translates the information into amino acids
emmainna [20.7K]

he cell's DNA is first transcribed in a temporary copy (mRNA), which is then translated into the amino acid sequence of a protein. amino acids – twenty molecules that are the building blocks of proteins.

5 0
3 years ago
Which of the following is not true about organic farming?
vodka [1.7K]
E) it produces food that do not contain artificial compounds
5 0
3 years ago
Read 2 more answers
Convert 63°F to degrees Celsius.
Deffense [45]

Answer:

C = 5/9(F - 32)

C = 35

35 = 5/9(F-32)

35 * 9/5 = (F-32)

(F-32) = 63

F = 63 + 32 = 95

8 0
3 years ago
Other questions:
  • What is one example of how humans affect the geosphere ?
    12·1 answer
  • How many Oxygen (O) atoms are in the following? H2O + CO2
    12·1 answer
  • What is the prefix in the medical term Microbiologist<br> A. Micro<br> B. Mi<br> C. Lst<br> D. Bio
    9·2 answers
  • 9) The reactions that produce molecular oxygen (O2) take place in
    13·1 answer
  • HURRY WILL MARK BRAINLIEST
    9·2 answers
  • How do living systems follow the law of conservation of mass and energy?
    10·2 answers
  • * Human skin color is an example of ✓
    14·1 answer
  • Where would a probe with the sequence aatcg bind to a target dna with the sequence ttttagccatttacgattaatcg (recall that dna sequ
    11·1 answer
  • Purple flowers are dominant over white flowers. The parent generations includes two heterozygous parents. What are the phenotype
    10·1 answer
  • Which of the statements about variation is NOT true? Select one:
    13·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!