1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Serhud [2]
3 years ago
13

PLEASE HELPPP!!!!

Mathematics
2 answers:
ExtremeBDS [4]3 years ago
7 0

Answer:

not proportional

Step-by-step explanation:

X: 0 1 2 3

Y: 0 2 3 4

To determine if it is proportional  take y/x  if it is a constant then it is proportional

y/x = 2/1 =2

y/x = 3/2 = 1.5

y/x = 4/3 = 1.333333

Not proportional

Alja [10]3 years ago
6 0

Answer:

not proportional

Step-by-step explanation:

had it on test i just got 100 on :)

You might be interested in
What is the reciprocal of<br> 8/5
azamat

Answer:

0.025

Step-by-step explanation:

7 0
3 years ago
Read 2 more answers
What is the total price of a $45.79 item when a 7% taxe is added
meriva

Answer:

$42.58

Step-by-step explanation:

You would multiply the price of the item (45.79) by the percentage as a decimal (0.07) and subtract the product.

in this case:

45.79x0.07 = 3.205 (rounded 3.21)

45.79-3.21 = 42.58

6 0
3 years ago
Which of the following is the graph of f(x) = x2 + 3x − 4?
chubhunter [2.5K]

The graph of the function for values of x ranging from -6 to +6 is shown below.

<h3>Graphing a Quadratic function</h3>

From the question, we are to graph the given quadratic function

The given quadratic function is

f(x) = x² + 3x − 4

The graph of the function for values of x ranging from -6 to +6 is shown below.

The table of values are

x       f(x)

-6      14

-5      16

-4      0

-3      -4

-2      -6

-1      -6

0      -4

1        0

2       6

3       14

4      24

5      36

6      50

Learn more on Graphing a quadratic function here: brainly.com/question/9028052

#SPJ1

8 0
2 years ago
Percent is a fraction where parts make one whole.
Alina [70]
4.4 part make a whole
5 0
3 years ago
Read 2 more answers
Help me please ASAP!
Goryan [66]
Probably graph W.....
3 0
4 years ago
Read 2 more answers
Other questions:
  • Mika can eat 21 hot dogs in 6 minutes. She wants to know how many minutes ( m ) it would take her to eat 35 hot dogs if she can
    10·1 answer
  • Parallelogram JKLM is shown on the coordinate plane below:
    9·1 answer
  • Find the percent of tip cost of meal $18.50, tip $2.59
    14·1 answer
  • What is 27 over 50 as a decimal and a percentage?
    7·2 answers
  • Which sequence of transformations creates a similar, but not congruent, triangle?
    14·1 answer
  • What is 12 2/3 as an improper fraction
    11·1 answer
  • What is the complementary DNA strand for the DNA strand<br> AATTGGCCATGCATGATTACGA
    7·2 answers
  • Hi can someone please check if my answer for this problem is correct
    12·1 answer
  • Find the 12th term of the sequence: 48, 44, 40, 36...<br> A.4 B.8 C.12 D.16 ​
    5·2 answers
  • Answers for these please. Geometry.
    13·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!