1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
stepladder [879]
2 years ago
7

A scientist is studying the age structure of a small country, which is shown in the following diagram.

Biology
1 answer:
uysha [10]2 years ago
4 0

Answer:

A :The population of the country is increasing at a rapid rate.

Explanation:

trust :)

You might be interested in
Which of the following is Not true about genome?
Nady [450]

Answer:

B-The human genome and a chimpanzee genome would be exactly the same.

4 0
3 years ago
What is the "snip" rule in Biology? <br>Thx so much♥♥​
goldenfox [79]

Answer:-if you "snip" below a node, a clade falls off

Explanation:

3 0
3 years ago
Read 2 more answers
Which of the following are causes of water pollution? (Choose all that apply.)
geniusboy [140]

Answer:

households, industries,

Explanation:

5 0
3 years ago
Read 2 more answers
WILL BRAINLIST CORRECT ANSWER PLATO
Dmitrij [34]

Answer:

I believe the first one would be incomplete dominance, the second would be multiple alleles, and the third would be codominance.

Explanation:

The first one would be incomplete dominance because the child has a blend of the man's straight hair and the woman's curly hair, but neither of two hair types are completely dominant (if that makes sense).

The second one would be multiple alleles because, well, there are multiple alleles listed (more straightforward than the other two).

And the third one would be codominance because the traits of red color and white color are equally dominant.

7 0
3 years ago
Linked genes are genes that Select one: a. assort independently. b. segregate equally in the gametes during meiosis. c. always c
nexus9112 [7]

Answer:

d. are found on the same chromosome

Explanation:

Linked genes are genes that <em>sit close together on the same chromosome,</em> this closeness makes higher the probability to inherit them together, meaning they won't follow Mendelian inheritance. Considering this information we can conclude that the correct answer is d. are found on the same chromosome.

I hope you find this information useful and interesting! Good luck!

4 0
3 years ago
Other questions:
  • Which genotype will offspring have if they inherit the a allele from both parents
    8·2 answers
  • Which molecule can diffuse from the digestive
    10·1 answer
  • Science question 1 What are the criteria for a good scientific question? Question 2 How do you formulate a good hypothesis?
    10·1 answer
  • Amino acids for- GACAAUGAAAGUUAGCAUGUGGUUGUGACGAAAG
    8·1 answer
  • Direct damage to tissue or an organ due to the effect of an antimicrobial on that tissue or organ is known as drug ________, whe
    7·1 answer
  • How have humans increased their biotic potential and carrying capacity?
    13·1 answer
  • What functional group is commonly used in cells to transfer energy from one organic molecule to another? hints what functional g
    12·1 answer
  • Snndjdudidododokdkdjbehe
    5·1 answer
  • Which phyla move by using pseudopodia?
    9·1 answer
  • Яке біологічне значення сну​
    12·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!