1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Licemer1 [7]
2 years ago
7

While driving, you see this pavement marking painted on the road ahead, in your lane. This

Law
2 answers:
sladkih [1.3K]2 years ago
5 0

Answer:

Cruce de Ferrocarril

Explanation:

igor_vitrenko [27]2 years ago
4 0

Answer:

Railroad Crossing

Explanation:

You might be interested in
A defendant was on trial for having committed a murder in 1995. Taking the stand, the defendant denied being present in the city
Snezhnost [94]

This is based on who is telling the truth. The defendant denys being in the city at the time of the murder, but then a local newspaper states that he heard gunshots from inside his apartment the day of the murder (which would be impossible if he wasn't in the city at the same of the murder). There could also be a chance that the newspaper could be lying mainly because the defendant  objected that the evidence was correct. In this case, the judge should take this into consideration especially when a local newpaper article announced that the defendant heard gunshots after saying that he was never in the city. So I would say, the newspaper article could be evidence to prove that the defendant is responsible for the murder.

8 0
2 years ago
Xd-965678lku;fbccccccccccccccccccccccccccccccccccccccccccccccccc
Art [367]
Yuhhhh get into it cccccndmska
4 0
3 years ago
Shirley and Bob are married, receive Social Security benefits and file a joint tax return. What is the base amount with which ½
NISA [10]

answer:

sorry i don't know the answer of these question ok but merry christmas to you ok having fun  and happy new year.

3 0
2 years ago
Read 2 more answers
How many repeats are there for this STR? Refer to the following DNA sequence to answer the questions: CTAGAAGCTTAAAGCTTCATCATCAT
andreyandreev [35.5K]

Answer:

The number of repeats within an STR is referred to as an allele. For instance, the STR known as D7S820, found on chromosome 7, contains between 5 and 16 repeats of GATA. Therefore, there are 12 different alleles possible for the D7S820 STR.

7 0
2 years ago
What could a ron be?
Sauron [17]

Short for run of network, in Online Advertising RON is a type of online ad buying campaign where the banner, image, media or text ads can appear on any Web site within an ad network.

6 0
3 years ago
Read 2 more answers
Other questions:
  • What does the Fifth Amendment's protection against self-incrimination mean?a. That a person only has to be a witness against him
    8·2 answers
  • Why does virtual schooling put stress on parents?
    6·2 answers
  • How would you react if an individual you were interviewing voluntarily revealed forbidden information?
    9·1 answer
  • If the free speech aspect of the First Amendment were up for ratification today,do you think it would pass in the same form as i
    6·1 answer
  • A compulsory workers’ compensation law claims that are made when an injury took place on the employer’s premises but did not ari
    8·1 answer
  • What is a decision by a judge or jury?<br> Warrant<br> Summons<br> Settlement<br> Verdict
    7·2 answers
  • What is the highest ranking for a police officer in San Diego
    6·2 answers
  • For younger drivers, which of the following is NOT considered a risk factor?
    7·1 answer
  • If an employee is injured in an automobile accident while she is driving to an off-premises restaurant during her personal lunch
    8·1 answer
  • What is the 7th amendment right in your own words
    5·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!