1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
inessss [21]
2 years ago
11

A fiber is found at a crime scene that appears to be identical to a reference sample taken from an item of clothing belonging to

one of the suspects in an investigation. Explain why this evidence alone would not be sufficient to establish a conviction.
Law
1 answer:
VashaNatasha [74]2 years ago
6 0

Answer: Because the suspect may have a reason for his or her fiber being there.

Explanation: if they are a roommate, friend, or someone who had access to the crime scene, the evidence of a matching fiber could easily be explained away. It is best to question a suspect about if they had been to that location before. If they say no, they are locked into that answer, thus there is no innocent excuse for the fiber being present.

You might be interested in
PLEASE HELP
shutvik [7]

Answer:

Explanation:

Dunno

8 0
3 years ago
Read 2 more answers
How many repeats are there for this STR? Refer to the following DNA sequence to answer the questions: CTAGAAGCTTAAAGCTTCATCATCAT
andreyandreev [35.5K]

Answer:

The number of repeats within an STR is referred to as an allele. For instance, the STR known as D7S820, found on chromosome 7, contains between 5 and 16 repeats of GATA. Therefore, there are 12 different alleles possible for the D7S820 STR.

7 0
3 years ago
The Judiciary Act of 1789 divided the nation into districts and created federal courts for each district.
GuDViN [60]
True !
The act established a three-part judiciary—made up of district courts, circuit courts, and the Supreme Court—and outlined the structure and jurisdiction of each branch.
please leave me a thanks!
8 0
3 years ago
Testamento y su clasificación
netineya [11]
Hi, can u check out my question thanks,
8 0
3 years ago
law is a practical discipline, theory has no place in law. With specific reference to the law of contract discuss. ​
yaroslaw [1]

Answer:

The reference about the law used is its clarity, efficiency and specificity.

Explanation:

When people claim that "law is a practical discipline, theory has no place in law," they mean that the law allows us to get specific answers from right and wrong, and not assumptions and concepts about what is right and wrong within. of a society, that is, if the law does not tolerate assumptions, the theory has no place within the law.

This can be seen, because a theory is an assumption about how something happens and an assumption of the events that cause it to happen.

The law is something clear, direct, dynamic and practical, which shows a certainty and not an assumption.

4 0
3 years ago
Other questions:
  • Facts on karsales v wallis case​
    14·1 answer
  • Please describe the state booking process in Florida (The Law booking process)
    5·1 answer
  • What counsel did Brigham Young give to Ephraim Hanks regarding the walls of his adobe house?
    11·1 answer
  • Which best explains how the president selects a justice for the Supreme Court?
    8·2 answers
  • Question 1
    9·2 answers
  • When driving during the daytime in reduced visibility, such as rain, smoke, or fog,
    5·2 answers
  • A State A citizen and a State B citizen were in a car accident in State A. The State A citizen filed a negligence action in a St
    10·1 answer
  • 4___4______5<br>123456789091918Q8Q
    12·1 answer
  • Vicky is taking Edward to small claims court. Vicky claims that Edward owes her money for a project she completed; Edward says t
    15·1 answer
  • Supply chain and operations management in my previous <br> workplace as a merchandiser at mall
    14·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!