1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Dmitry [639]
2 years ago
10

Hello people ~

Biology
2 answers:
telo118 [61]2 years ago
8 0

Answer:

Herkogamy

Explanation:

  • Glorious superba is a exception kind flower type
  • Unlike others flowers it's not bise xual
  • Polleniated grains can't reach stigma

Option A

mr_godi [17]2 years ago
7 0

Answer:

a) Herkogamy

Explanation:

Gloriosa Superba or Flame Lily exhibits herkogamy.

Here, there's a considerable separation between the male & female flowers in the same plant (occurs in bise.xual plants / plants which follow cross pollination). The separation is there so that less self pollination between the plants take place. These plants are known as herkogamous plants. The flowers are positioned accordingly to allow pollination to occur.

______

Hope it helps ⚜

You might be interested in
2) A segment of DNA that is artificially created from two or more organisms, through use of DNA enzymes in a laboratory is calle
MAXImum [283]
How about "recombinant DNA?" Which is the result of DNA cloning as ttom suggests.

5 0
3 years ago
Read 2 more answers
A man with type AB blood is married to a women with type O blood. They have two natural children and one adopted child. The chil
Jobisdone [24]

Answer:

<em>The child with the blood type O will be adopted. </em>

Explanation:

A punnet square can be described as a diagram which is made to depict the outcomes of a cross.

To determine the possible blood groups of the children with parents having AB and O blood group, lets make a punnet square:

        O          O

A    AO      AO

B    BO      BO

The punnet square shows that the children produced will have 50 percent chance of having A blood group and a 50 percent chance of having a B blood group. Hence, we can tell that the child with O blood group is adopted.

5 0
3 years ago
Type of genetic material
AlexFokin [52]

Answer: DNA

Explanation:

5 0
3 years ago
What is the mRNA that would be transcribed from this strand of DNA?
Illusion [34]

Answer:

AUGUUAGUUCGUGAACGUUCUGAUUAA if its rna transcription and replace the U's with T's if its dna replication

Explanation:

8 0
2 years ago
What grows inside the structure pictured below?<br><br> It’s a flower by the way.
nexus9112 [7]

What grows inside of a flower?

Many things. does the image point to something specific? if not just put nectar.

7 0
4 years ago
Other questions:
  • The ends of roots are normally covered in tiny root hair cells. what is their function?
    8·2 answers
  • What is the connection between the liver (organ), UV radiation (sunlight), and bone tissue?
    12·1 answer
  • What are the three different types of plague that result from the Yersinia pestis? Describe each type.
    9·1 answer
  • What are ribosomes? what do they do?
    8·1 answer
  • Which of the following is not true?
    9·1 answer
  • 2. Suppose that a broth culture has 52 million bacteria per milliliter. A serial dilution is made using three bottles of 99 mill
    11·1 answer
  • You can use light produced by ____ to heat food.
    12·1 answer
  • What is the function of amylase
    11·1 answer
  • Evolution is sometimes a controversial topic. Write an essay (minimum 5 short paragraphs) including the following:
    8·1 answer
  • What is an example of structural adaptation of humans?
    9·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!