1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
kari74 [83]
2 years ago
11

How does a snowy owl find its way back

Biology
1 answer:
Wittaler [7]2 years ago
8 0

Answer:

Dense camouflaged feathers (anatomical) - Snowy owls have white camouflaged feathers to help them blend into the white landscapes of the arctic. Their feathers extend thickly over all parts of the body unlike other owls which often have less on the face and legs in particular, the toe feathers of the snowy owl are more than twice as long as the next longest on an owl.

Explanation:

You might be interested in
The biological levels of organization range from a single cell all the way up to the biosphere in a highly structured hierarchy.
ELEN [110]

Answer:

B) Tissue is made of different types of cells.

D) Organs are made of different types of tissue.

Explanation:

The tissues are made of different types of cells. The organs are also made of different types of tissue. There is no need of same types of tissues to make organs. Thus, option (B) and (D) is correct answer.

7 0
3 years ago
Read 2 more answers
why are individuals with an extra chromosome 21, down syndrome, more numerous than individuals with an extra chromosome 3?
givi [52]

Extra copies of the other chromosomes are probably fatal to the developing embryo that's why individuals with extra chromosome 21 are more numerous than extra chromosomes 3 or 16.

The term "aneuploidy" in genetics refers to the alteration in chromosomal number 23, which can result in hereditary disorders. An individual is said to be aneuploid if they have fewer chromosomes than the wild or euploid type due to an additional or missing chromosome, which is invariably linked to a lack of either physical or mental development or both. This happens during errors in meiosis, the type of cell division that takes place during the development of gametes, which are sex cells that give rise to zygotes during fertilization.

Non-disjunction is a failure of the meiotic process, in which two chromatids or chromosomes pair up and one pole receives nothing. When homologous chromosomes fail to split properly during meiosis I, two defective cells are produced as a result: one has an extra chromosome and the other lacks a chromosome. The chromatids in the chromosomes separate during meiosis II, which may also result in the formation of abnormal cells.

The trisomy on chromosome 21 is more prevalent because the condition is not fatal. Trisomy on a different pair of chromosomes, however, can often be fatal. Having an extra chromosome impacts the way a newborn develops both physically and intellectually. The newborn and future adult may face a variety of mental and physical difficulties as a result of these changes. This is because the DNA in those chromosomes changes how much protein is made and is encoded by them.

The complete question is:

Why are individuals with an extra chromosome 21, which causes Down syndrome, more numerous than individuals with an extra chromosome 3 or chromosome 16?

(A). There are probably more genes on chromosome 21 than on the others.

(B). Chromosome 21 is a sex chromosome, and 3 and 16 are not.

(C). Down syndrome is not more common, just more serious.

(D). Extra copies of the other chromosomes are probably fatal to the developing embryo.

(E). The nondisjunction of chromosomes 3 and 16 probably occurs much less frequently.

To learn more about chromosomal disorders please click on the given link: brainly.com/question/29100880

#SPJ4

5 0
1 year ago
Question 9 of 10
arsen [322]

Answer:

B

Explanation:

a cell does NOT destroy energy

6 0
3 years ago
Read 2 more answers
sequence 1 has a blank muation original: ATCGCCGGAATAGGCATCAGCAGT SEQUENCE 1: ATCGCCCGAATAGGCATCAGGAGT
Nonamiya [84]

Answer:

interesting

Explanation:

I love this, good job. Have a great day :))

4 0
3 years ago
What is a diffusion
denis-greek [22]

Answer:

Explanation:

Diffusion is net movement of anything from a region of higher concentration to a region of lower concentration. Diffusion is driven by a gradient in concentration. The concept of diffusion is widely used in many fields, including physics, chemistry, biology, sociology, economics, and finance.

4 0
3 years ago
Other questions:
  • What is the minimum dose that results in reddening of the skin?
    6·1 answer
  • A biome is a broad category of ecological organization that includes all of the biotic and abiotic components of an entire clima
    8·2 answers
  • Which of these indicates equilibrium in the community? A. seral B.pioneer C.ultimate D.intermediate E.climax
    13·2 answers
  • Consider that it takes, on average, 24 hours (or 1,440 minutes) for each onion root tip cell to complete the cell cycle. You can
    13·1 answer
  • Explain how bones attach to each other and to muscles and how this aids movement.
    10·2 answers
  • Why is Earth's outer core hotter than Earth’s oceanic crust? Earth’s oceanic crust is denser than Earth’s outer core is. Earth’s
    13·2 answers
  • What does the nucleosome<br> do?
    11·1 answer
  • We know that the pressure of water increases with depth. Then, which of the following shows the most possible shape of a dam?
    5·2 answers
  • Carbon is released to the atmosphere by
    8·1 answer
  • In humans, six fingers (f) is the dominant trait; five fingers (f) is the recessive trait. if the father is heterozygous for six
    9·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!