All categories

2 years ago

Which energy-rich molecule produced by cellular respiration directly powers cell work?.

Biology

1 answer:

GaryK [48]2 years ago

3 0

Answer:

A single glucose molecule produces about 38 molecules of ATP through the process of cellular respiration.

Explanation:

Cellular respiration is a metabolic pathway that breaks down glucose and produces ATP.

I hope this helps. :)

You might be interested in

Write a one-paragraph (5-7 sentences) reflection on the dangers of drugs and how they can interfere with you achieving your goal

zysi [14]

Answer:

They can reflect on getting a Job and doing good in life, they could kill a person without them even knowing it. The dangers of drugs Is that they can mess up your life or it could make you so messed up things to yourself. Drugs are bad because they could make life worse, and they could hurt people around you or people you love, drugs can lower your chances of achieving your goals because you could easily get fired or you can lose your mind enough just not to know what you're doing.

Explanation:

4 0

3 years ago

Note the two transcribed and translated DNA strips below. The two strips are identical except for a point mutation, where the fi

jekas [21]

Full question attached

Answer/ Explanation:

The original DNA sequence has a point mutation changing a G to a T. The resulting mRNA produced is always complementary to the DNA from which it is synthesised, so the original mRNA sequence has a T, whereas the mutated mRNA has a U. The tRNA is complementary to the mRNA, so the original has a G, and the mutated has a T.

<h3>Original DNA</h3>

GTTGGCGAATGAACGGAGGCTGACGTCTAAGCCTAGAAAAATTGG

RNA

CAACCGCUUACUUGCCUCCGACUGCAGAUUCGGAUCUUUUUAACC

tRNA

GUUGGCGAAUGAACGGAGGCUGACGUCUAAGCCUAGAAAAAUUGG

<h3>_______________________________________________</h3><h3>Mutated DNA</h3>

GTTGGCGAATGAACTGAGGCTGACGTCTAAGCCTAGAAAAATTGG

RNA

CAACCGCUUACUUGUCUCCGACUGCAGAUUCGGAUCUUUUUAACC

tRNA

GUUGGCGAAUGAACTGAGGCUGACGUCUAAGCCUAGAAAAAUUGG

This is a point mutation called a substitution. This does not affect the entire sequence of the protein, because the mutation is "in frame" meaning the mRNA sequence is still read in the same way by the protein producing machinery. However, it does change the 5th codon from UGC to UGU. If we look up the genetic code, we can see that both of these codons code for cysteine, so there will be no change in the amino acid sequence of the protein

5 0

3 years ago

What are the stages of meiosis in eukaryotic cells with realizing that there are two cell divisions involved?

goldenfox [79]

Answer:

Meiosis can only occur in eukaryotic organisms. It is preceded by interphase, specifically the G phase of interphase. Both Meiosis I and II have the same number and arrangement of phases: prophase, metaphase, anaphase, and telophase. Both produce two daughter cells from each parent cell.

7 0

3 years ago

Which organism contains tissues?

prohojiy [21]

The correct answer would be A. seal as paramecium, bacterium, and amoeba are all single-celled organisms. Thus, they cannot be an organism with tissues.

3 0

3 years ago

Read 2 more answers

Is infant circumcision ethically necessary?

Nostrana [21]

The answer is that infant circumcision is not ethically necessary. The reason to this is that there are no proof of evidence as to why it is ethically necessary for it to be done to an infant. It is also because other medical professionals thinks that doing circumcision in an infant will create issues in terms of their health, producing complications. That is why it is not ethically necessary for it to be done on an infant.

6 0

3 years ago