Answer:
The correct answer is 50%
Explanation:
Fraternal twins are the twins which are produced from the fertilization of two different eggs by two different sperms. These eggs are released at the same time.
So as fraternal twins are produced from fertilization of two different eggs therefore they share 50% of genes with each other just like other siblings. They are also called dizygotic twins
Identical twins are produce from a sigle fertilized cell which later divides into two cell mass. Indentical twins share 100% gene. Therefore the correct answer is 50%.
Check on google they will give you the answer and others descriptions
<span>Trophic level—90% of energy consumed at trophic
level is used by the consumer for survival and reproduction. The remaining 10%
is transferred to the next trophic level. So the answer is 10,000 x 0.9
or 9,000 calories will be generally available
to primary consumer</span>
Answer:
a. Inversion
b. Duplication
Explanation:
Inversion has the name suggest, has to do with a segment of DNA being reversed from end to end.
In this case here,
Inversion is taking place here.
species 1 ATGCAAATTTGGGCCCATGAATGGTTGCAA
species 2 ATGCAAAAATTTTGGTACGCCGAATGGTTGCAA
Therefore, the sequences in bold in species 1 are observed to be reversed end to end in species 2.
Deletion ❌❌
I am sure it's not feasible because deletion entails removal of a few sequences.
It can be seen that species 2 is longer than species 1, which gives another reason why deletion is not feasible too, as no sequences are seen to be deleted.
I believe duplication is feasible since AATT sequences are repeated once.
Our final answer,
inversion and duplication occur here.
