1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
ddd [48]
2 years ago
7

Which best describes conjunction in bacteria?

Biology
1 answer:
trapecia [35]2 years ago
6 0

Answer:

which best describe conduction in bacteria but I also had that bacteria conjunction is the transfer of genetic material between bacterial cells by direct cell to cell which contacts buy a bridge like connection

You might be interested in
Can some one code this dna
cluponka [151]

Answer:

After replication, identical copy of the Double stranded DNA is produced. Complementary strand for each of stand given below is

Explanation:

 1. AACGTACGATCGATGCACATGCATGGCTACGC

Complementary strand  

     TTGCATGCTAGCTACGTGTACGTACCGATGCG

Protein encode: NVRSMHMHGY

2. CCCGGGTATGCATGTACGTACGTCGTATATCG

Complementary strand  

     GGGCCCATACGTACATGCATGCAGCATATAGC

Protein encode: PGYACTYVVY

3. CGCGATCGAGCGATCGACGAATGCCTAGTTTT

Complementary strand  

   GCGCTAGCTCGCTAGCTGCTTACGGATCAAAA

Protein encode: RDRAIDECLV

4. TTAAACGAGCTGCTAGCTATTTTTAAAACCCCG

Complementary strand  

   AATTTGCTCGACGATCGATAAAAATTTTGGGGC

Protein encode: LNELLAIFKTP

7 0
3 years ago
A lab rat had part of its hypothalamus destroyed. the rat seems to have lost all interest in food and won't eat even when food i
mixas84 [53]
Hungry nerve has been 
8 0
3 years ago
Two black guinea pigs of the same genotype were mated and produced 29 black and 9 white offspring. what would you predict the ge
Archy [21]
Hey there!

It can be assumed that the two black guinea pigs have one dominant gene, black fur, and one recessive gene, white fur. Using BB, Bb, and bb, when you look at this on a Punnett square, one out of the four boxes will be BB, which will end up with black fur, two boxes will be Bb, which will also end up with black fur, and one box will be bb, which will end up with white fur. If the parent guinea pigs were BB, all of the offspring would be black. If they were bb, they would be white instead of black. 

Hope this helped you out! :-)
3 0
3 years ago
Why do scientist use the light year instead of astronomical units to measure the distance between stars ?
Evgesh-ka [11]
Astronomers use light years to measure distances in space because space is so massive and distances so far that conventional numbering is inadequate and unmanageable. One light year is a distance measurement equivalent to six trillion miles.
6 0
3 years ago
Read 2 more answers
What is the expression used with proteins?
dedylja [7]

Protein expression refers to the way in which proteins are synthesized, modified and regulated in living organisms.

Hope this helps :D

5 0
3 years ago
Read 2 more answers
Other questions:
  • The variations that exist in a population of wild giraffes are usually a result of events that occur during
    10·1 answer
  • In a flower , the female sex cells or eggs are produced by the________.
    6·2 answers
  • When males reach a certain age, the body begins the process of puberty. how does the body control this process?
    12·2 answers
  • Which features form near convergent oceanic plates? Select the two correct answers.
    13·1 answer
  • What is the first step in a scientific investigation?
    13·1 answer
  • The electrons that chlorophyll loses to electron transport chain are replenished by
    12·1 answer
  • The ancient fish fossils were dated using C-14. If 1/16 the original amount of C-14 remains in the skeletons, approximately how
    10·1 answer
  • The diagram shows the female reproductive system. What structure is indicated by the arrow?
    6·2 answers
  • What is muscle tissues funtion
    6·1 answer
  • 17. The mass of the products of a chemical reaction the mass of the reactants.
    9·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!