Answer:
A bacteriophage is a type of virus that attacks bacteria. In the lytic cycle, the virus hijacks the cell machinery of the bacterium that it has infected. In the lysogenic cycle, the viral DNA is incorporated into the bacterial DNA.
Explanation:
Its a type of virus.
It starts as a raindrop which is rain than it goes to the ocean,rivers,puddles or any body of water and from there it evaporates which makes the clouds and than it starts all over when the clouds already got enough water.
Don’t know about trout but eagles and wolves would be affected by the heat from the volcano
Answer:
because it reduces the number of chromosomes to half the normal number so that, when fusion of sperm and egg occurs, baby will have the correct number.
Explanation:
hope this helps
plz mark brainliest
Answer:
Write the complementary sequence to the following DNA strand: AATTCGCCGGTATTAGACGTT
TTAAGCGGCCATAATCTGCAA
Explanation:
