1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Lilit [14]
3 years ago
11

Mutation is one cause of variation. State one other cause of variation.

Biology
2 answers:
natulia [17]3 years ago
6 0
Two other causes of variations
1.Gene flow
2. Sex

Anestetic [448]3 years ago
3 0
Here are at least 2:distribution,and Mating Patterns.
You might be interested in
TACAAACACTATACCGCGTAAATGATT Write the complement to the strand of DNA shown above, break it up into the proper triplets.
netineya [11]

Answer:

The complementary base pair is ATG  TTT   GTG   ATA TGG  CGC  ATT  TAC   TAA  

Explanation:

As per the complementary base pairing rule of DNA

C pairs with G and vice versa

A pairs with T (in DNA) or U (in RNA)

Breaking the given strand into triplets, we get -

TAC  AAA  CAC  TAT  ACC  GCG  TAA  ATG  ATT

ATG  TTT   GTG   ATA TGG  CGC  ATT  TAC   TAA  

5 0
3 years ago
Where do animals obtain their chemical energy from
Sunny_sXe [5.5K]

From the food they intake in different ways such as Plants or other animals such as insects which are their fuel

8 0
3 years ago
Only one of the two strands of DNA is transcribed because
Westkost [7]
Only one strand will be transcribed and the other servers as a coding stand. ... Without it, the single strand DNA with exposed nitrogenous bases is very unstable so two strands actually stabilise the structure.
6 0
3 years ago
How is the genotype of the offspring different from that of the homozygous dominant parent?
tatuchka [14]

Since it's been crossed with a homozygous wrinkled green, the offspring has a genotype for heterozygous round and yellow. As round and yellow are dominant traits, they're expressed in the phenotype. But when self pollinated in the f2 generation, the recessive ones will show as well

Hope it helps :')

8 0
3 years ago
Explain why offspring of plants exposed to radiation may have characteristics not found in the original population.
iVinArrow [24]
Radiation can damage DNA. This could result in a change in the proteins which make up the plant's physical structure. 

<span>For example, a plant might have a gene for purple pigment which makes its flowers purple. Radiation might change the DNA sequence so that the directions for making the purple pigment tell it to stop prematurely, and the result might be white flowers rather than purple flowers.</span>
5 0
3 years ago
Other questions:
  • How do earthworms obtain their food, and what happens to it when it is digested?
    13·1 answer
  • Shouldn't this be respiration and photosynthesis not as its spelled here?
    14·1 answer
  • The major mechanism driving cellular differentiation is the difference in gene..... A) Expression B) Sequences C) Order D) Repli
    11·1 answer
  • Identify the role of burning wood, fossil fuels, and decomposition in the carbon cycle
    6·1 answer
  • HELP!!! Please this is for plato The part labeled A is a<br> And the part labeled B is
    10·2 answers
  • ______ of Jupiters mass is made of hydrogen, followed by about ______ of helium.
    6·1 answer
  • Most Americans marry individuals with characteristics similar to their own, including
    6·2 answers
  • Which environmental factor could lead to a decrease in genetic variation in a population of tuna?
    8·2 answers
  • How does the bone protect the immune system?<br><br> please help
    11·1 answer
  • Which of the following is a characteristic of hydrologic fracturing?
    15·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!