1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
emmasim [6.3K]
1 year ago
5

What climate change solution gave you the most hope for our future? explain why!

Biology
1 answer:
liq [111]1 year ago
5 0

Answer:

Changing energy to clean energy. This solution gave me some hope because we would stop using non-renewable resources, which are harmful to the environment.

You might be interested in
What happens when the cell empties itself of water
antoniya [11.8K]
It Is this turgor pressure that holds the cell firm and provides the characteristics of of plant structures such as leaves. When a plant has been without water for a very long time the central vacuole lose water which results in the cells losing its shape, and the whole leaf wilts.
3 0
2 years ago
A prescription for an isotonic enema is written for a 2-year-old child. what is the maximal amount of fluid the nurse should adm
ELEN [110]

If in the prescription written for a 2-year-old child for an isotonic enema, the amount of fluid to be administered is not precisely specified by the healthcare provider, the maximal amount of fluid the nurse should administer to the child is 255 to 360 mL

4 0
3 years ago
Select the best answer for the question
zzz [600]
A because idn hope u find the answer
4 0
2 years ago
What is the mRNA sequence to match the DNA sequence below:<br><br> TACGCTCCATATCGCTAATCGCCGGATCAGATT
Kazeer [188]
AUGCGAGGUAUAGCGAUUAGCGGCCUAGUCUAA because A goes to U; T goes to A; G goes to C; C goes to G.
8 0
2 years ago
Read 2 more answers
Members of this arthropod group have three body parts...
son4ous [18]
<span>Crustaceans
these are the members that have 3 body parts!!!!
please mark brainliest</span>
4 0
3 years ago
Other questions:
  • Use Bacteriology in a sentence
    13·1 answer
  • What did lashley develop by purposely damaging the brains of rats that had learned a task and then testing those rats to see if
    6·1 answer
  • In Western civilization, fingerprinting has been used in crime detection for many hundreds of years.
    8·2 answers
  • Describe what happens when you click on the chromosomes during telophase I.
    8·1 answer
  • What is the name of the substance that a transported sediment moves through?
    15·2 answers
  • This map shows how climate change might affect precipitation patterns in the Great Plains of the United States by the end of thi
    5·2 answers
  • Can someone check my work?
    7·2 answers
  • Why is distinction of crude density and ecological density necessary? and which one of these densities are greater?
    12·1 answer
  • What are some ethical and philosophical questions that surround the issue of
    13·1 answer
  • What did belt mean by “ I saw the handiwork…starting with the road itself”
    13·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!