1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
galina1969 [7]
2 years ago
8

How might a clogged blood vessel affect the nervous system’s and the endocrine system’s abilities to deliver signals?

Biology
1 answer:
kvasek [131]2 years ago
8 0

Answer:

The transport of signals by the endocrine system may be slowed by blocked blood vessels, but not by the neurological system.

Explanation:

You might be interested in
What is the mRNA in TACCGGATGCCAGATCAAATC?
Softa [21]

Answer:

AUGGCCUACGGUCUAGUUUAG

3 0
3 years ago
In a certain population, the allele causing sickle cell anemia has an allele frequency of 0.2. if the population is in genetic e
alexandr1967 [171]
The answer is "0.64".
8 0
3 years ago
Pole beans need something to grow around and up. What kind of stimull can encourage this type of growth?
Misha Larkins [42]

I'd say create a compost bin. Hopefully this was what you were looking for.

8 0
2 years ago
How many food chains are in this food web?
Andre45 [30]

Answer:

There are 8 food chains

Explanation:

5 0
3 years ago
It is easier to read while shaking your head than while shaking the page. why
Vedmedyk [2.9K]

The reason why it is much easier to read while shaking your head rather than reading and shaking the page is because of the vestibular ocular reflex, it is because when reading and shaking your head the vestibular ocular reflex were able to respond faster than prolong and slow movements.

6 0
3 years ago
Other questions:
  • How does a well for Community affect ocean sediment
    14·1 answer
  • What is the basis of an organic molecule?
    9·2 answers
  • What is the definition of Organelle? And what could be a good example?
    9·1 answer
  • Microwaves are produced when (2 points)
    13·1 answer
  • Using a loan could help with the purchase of which of the following?
    14·1 answer
  • Three examples of complex hereditary diseases are cardiovascular disease, type 2 diabetes, and .
    12·1 answer
  • In order for an object to move in uniform circular motion, it must not be
    10·2 answers
  • If frogs are edible, why can't we eat cane toads?
    14·1 answer
  • Looking at the Punnett square, list the possible phenotypes and frequencies of
    6·1 answer
  • A Bengal tiger wades through the Sundarbans mangroves
    6·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!