1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Alexus [3.1K]
3 years ago
13

HELP!! what is 23x+(4-5b)

Mathematics
1 answer:
Tamiku [17]3 years ago
3 0

Answer:

just remove the bracket and write normally so it's 23x+4-5b

Step-by-step explanation:

if you meant something else then let me know

You might be interested in
Dominick has 24 baseball awards and 18 soccer awards. He wants to build shelves so that he can display all his awards. He wants
soldier1979 [14.2K]

List the multiples of each award:

24: 1 , 2, 3, 4, 6, 8, 12, 24

18: 1, 2, 3, 6, 9, 18

The greatest common multiple is 6

The greatest number of shelves will be 6.

4 0
3 years ago
You go to an arcade to play games.
aalyn [17]

y-y1=m(x-x1)

y-10=512(x-0)

5 0
4 years ago
Read 2 more answers
PLEASE HELP!!!
gregori [183]
Your answer is B. I hope this is helpful!
3 0
3 years ago
Evaluate f ( - 5 ) =
Firdavs [7]

Answer: −5

Step-by-step explanation:

simplify: (−5)

Re-order terms so constants are on the left:

(−5)f(−5)−5

6 0
2 years ago
Football practice is 3 hours long and is normally split equally into two parts basic warm up exercises and practicing football p
dolphi86 [110]

Answer:

1.5 hours.

Step-by-step explanation:

Football practice is 3 hours long, divided into 2 equal parts.

3/2=1.5.

So, 1.5 hours or 1 hour and 30 minutes is spent doing warm up exercises and the other 1 hour and 30 minutes is spent practicing football plays.

4 0
3 years ago
Read 2 more answers
Other questions:
  • Tom spent 2.5 hours mowing his neighbors yard. If Tom spent $5 on gas and was paid $25 total. How much
    8·1 answer
  • I need the help for number 7 plz help me as soon as possible plz help me
    6·1 answer
  • Explain the meaning of each of the following. (a) lim x → −3 f(x) = [infinity] The values of f(x) can be made arbitrarily close
    5·1 answer
  • Which of the following statements describes the difference between the range and the interquartile range? A. The range is a numb
    9·1 answer
  • Using the box-and-whisker plot shown, find the quartile values Q1 and Q3
    14·1 answer
  • 10.2x + 3.2 = 4.6<br> solve with steps please `\_(^v^)_/`
    14·1 answer
  • What is the complementary DNA strand for the DNA strand<br> AATTGGCCATGCATGATTACGA
    7·2 answers
  • PLZ HELP ILL GIVE YOU THE BRAINLIEST IF RIGHT‼️ <br> I need the simplified answer :)
    14·1 answer
  • What is the unit rate if 65 miles in 2 ½ hour.
    6·2 answers
  • A side of the triangle below has been extended to form an exterior angle of 128°. Find the value of x.
    8·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!