1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Gala2k [10]
2 years ago
10

How was your day quetson

Biology
1 answer:
mr_godi [17]2 years ago
3 0
Why do u keep making this question?
You might be interested in
If beetles are found around a body this indicates that thw body has been dead for how many hours?
sladkih [1.3K]

Answer:

Forensic entomology also helps determine an estimate of how long a person or animal has been deceased or the Post Mortem Interval (PMI). Investigators can determine this from insects by studying the development of the insect. An adult insect will fly around until it finds a body that is suitable for it to lay its eggs.

Explanation:

8 0
4 years ago
100%<br> Bob put on a costume while playing at school. Maria said, "You're an amphibian!"<br> Which animal is Bob?<br> A. bird<b
AveGali [126]

Answer:

C: Frog

Sorry about my last answer

8 0
3 years ago
Which of the following is not a normal body response to heat?
poizon [28]

Answer:

c. decrease rate of muscle activity

4 0
3 years ago
E. Suppose a poll of 30 people in a neighborhood
Murrr4er [49]

Answer:

30 people gsbsnskskdbbdgdvdvsbwnkembdvrvgeh

4 0
3 years ago
Help I need this done thx.
shusha [124]
Flagelle - 4
Pseudopod - 2
Autotroph - 8
Prokaryote - 1
Heterotroph - 3

Hope this helps ;)
6 0
3 years ago
Other questions:
  • Where would a probe with the sequence AATCG bind to a target DNA with the sequence TTTTAGCCATTTACGATTAATCG (recall that DNA sequ
    12·1 answer
  • A clinical research study is evaluating cells that bridge both the innate and adaptive immune systems. A nurse has identified th
    10·1 answer
  • Describe the process of speciation. Include in your discussion the factors that may contribute to the maintenance of genetic iso
    14·1 answer
  • During a high-energy athletic event, such as a sprint, most of the energy that is provided to the muscles comes from
    15·2 answers
  • Where are cardiac pacemakers usually positioned during​ implantation?
    11·1 answer
  • Without photosynthesis life as we know it would not exist on Earth. <br><br> True or False
    11·1 answer
  • What might be one limitation of using a greenhouse as a model to represent a large farm?
    8·2 answers
  • How are pluripotent and mutipotent cells similar? How are they different?
    15·2 answers
  • ¿Cómo afecta el uso de excesivo de un recurso,cómo árboles y plantas,nuestro medio ambiente?
    5·1 answer
  • If a DNA molecule has 40% Cytosine, what percent of it would be Adenine? Explain your reasoning.
    14·2 answers
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!