If only a single member of a pair of chromosomes is present in a cell, it is a _ condition and is most likely a _ cell.

1 answer:

8 0

The answer is B. haploid; reproductive.

A haploid cell contains half the number of chromosomes found in the diploid cell, namely, it contains only one set of chromosomes. So, the condition must be haploid. The gamete cells in the organism are sperm cells and egg cells, thus, reproductive cells. So, the condition must be reproductive.

You might be interested in

A certain segment of DNA can be used as a molecular clock. Its rate of mutation is one mutation per 20 million years. Examine th

IgorC [24]

Let's calculate the difference in nucleotides. The number of difference multiplied by rate of mutations will help to determine how long ago these two species shared a common ancestor.

Species A: GTACCTAAGTTCACCGAATT
Species B: GAACCTAAGGGCACCGAACT

These species differ in 4 nucleotides.
This number should be multiplied by the rate of mutations

5 0

3 years ago

Penicillin has ability to provoke immune response by itself. true or false?

Levart [38]

Answer:

true

Explanation:

Penicillin is a bacteria so it means it causes the production of antibodies which then boost the immune system.

It is like vaccination; small doses of the inactive form of the infection is injected into the body in order for the body to create antibodies resistant to such infection(thereby boosting the immune system).

Hope it helps.

5 0

3 years ago

At sea level a kilogram weighs approximately?

valentinak56 [21]

Answer:

2.2 pounds.

Explanation:

a kilogram is 2.2lbs, and at sea level weighs 2.2 pounds, as sea level is the same as 0ft.

4 0

3 years ago

Read 2 more answers