Answer: The structure of the spinal cord can be described as consisting of all the above named.
Explanation:The spinal cord is the main pathway for information connecting the brain and peripheral nervous system. Much shorter than its protecting spinal column, the human spinal cord originates in the brainstem, passes through the foramen magnum, and continues through to the conus medullaris near the second lumbar vertebra before terminating in a fibrous extension known as the filum terminale.
It is about 45 cm (18 in) long in men and around 43 cm (17 in) in women, ovoid-shaped, and is enlarged in the cervical and lumbar regions.
B. Observing the nocturnal behavior of coyote populations
Answer:
a.The template DNA strand, from which the mRNA is synthesized, is 5’ CAAACTACCCTGGGTTGCCAT 3’
(RNA synthesis proceeds in a 5’ à 3’ direction, so the template strand and the mRNA will be complementary to each other)\
b.The coding DNA strand, which is complementary to the template strand, is 5’ ATGGCAACCCAGGGTAGTTTG 3’
c. The sequence of the mRNA is 5’ AUGGCAACCCAGGGUAGUUUG 3’
(the sequence of the mRNA is complementary to the template strand and identical to the coding strand with U substituted for T)
d.The third codon is 5’ ACC 3’. Therefore, the corresponding anti-codon is 5’ GGU 3’
Answer: Just navigate the rout
Explanation: always multpy and get the answer easy
I am 99% sure its openness. but then again theirs that 1%. <span />
