1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Bezzdna [24]
2 years ago
13

Which type of immunity is long lasting and why?

Biology
1 answer:
slega [8]2 years ago
7 0
You are likely referring to active immunity that can come from naturally acquiring the disease or vaccines. Both have T cells that fight pathogens and more antibodies are created to recognize viruses and the like and neutralize them. B cells can make more antibodies. There is a lot more detail to this question but hope it helps. Have a good day.
You might be interested in
You measure levels of Ca2+ in various locations within a motor neuron and a skeletal muscle fiber when the motor neuron is NOT d
gogolik [260]

Answer:

The correct answer is 3: "<em>High levels of Ca2+ are expected to be found </em><em>within the sarcoplasmic reticulum</em>".

Explanation:

Muscular contraction is a highly regulated process that depends on free calcium concentration in the cytoplasm. Amounts of cytoplasmic calcium are regulated by <u>sarcoplasmic reticulum</u> that functions as a storage of the ion.

When a nerve impulse reaches the membrane of a muscle fiber, through acetylcholine release,  the membrane depolarizes producing the entrance of calcium from <u>extracellular space</u>. The impulse is transmitted along the membrane to the sarcoplasmic reticulum, from where calcium is released.  At this point, <em>tropomyosin is obstructing binding sites for myosin on the thin filament</em>. The calcium channel in the sarcoplasmic reticulum controls the ion release, that activates and regulates muscle contraction, by increasing its cytoplasmic levels. When <em>calcium binds to the troponin C</em>, <em>the troponin T alters the tropomyosin by moving it and then unblocks the binding sites,</em> making possible the formation of <em>cross-bridges between actin and myosin filaments.</em> When myosin binds to the uncovered actin-binding sites, ATP is transformed into ADP and inorganic phosphate.

Z-bands are then pulled toward each other, thus shortening the sarcomere and the I-band, and producing muscle fiber contraction.

4 0
3 years ago
5’AUGAGGGCGAGCGGCGCCCACGUUUUAGGGUGA3’
stepladder [879]

I believe this is translation and it occurs in the mRNA strand due to proteins call the initiation, elongation and release factors.

7 0
3 years ago
Plz help I need help asap lots of points
Kobotan [32]
If it contians 1/16th the amount, it must have gone through 4 half lives: 1>  1/2> 1/4> 1/8> 1/16>.since the half-life of c-14 is about 5730 years, the age of the fossil is 4 X 5730 years or about 22,920 years old.

4 0
3 years ago
Lysosomes are membrane-bound vesicles produced by the Golgi apparatus that contain ____________ enzymes.
sp2606 [1]

Answer:

Lysosomes are membrane-bound vesicles produced by the Golgi apparatus that contain DIGESTIVE enzymes.

Explanation:

Such as glycosidases, proteases and sulfatases.

3 0
2 years ago
What happens to farmland during desertification?
Usimov [2.4K]
It loses alot of soil minerals as a result of no availability of green plants
3 0
3 years ago
Other questions:
  • The general term given to male sex hormones is______?
    11·1 answer
  • Sometimes genes, for no known reason(s), change their form in a process called
    10·1 answer
  • If the amount of sodium in the blood increases, what would a negative feedback control mechanism be expected to do?
    14·1 answer
  • List and describe an example of matter moving between spheres
    5·1 answer
  • If the gametes produced by a given organism contain 6 chromosomes, how many chromosomes are found in that organism’s body cells?
    14·1 answer
  • 25. Which of these does natural selection work on?
    15·1 answer
  • What happen to the brain and the brain cavity?
    12·1 answer
  • Tell me one thing you know about replication.
    11·2 answers
  • T or F. The total number of deer, bears, hawks, and mice in a forest forms a population for that area.
    5·1 answer
  • Which of the following best describes the relationship among latitude, altitude, and climate?
    13·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!