1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Oliga [24]
1 year ago
6

Did you model weathering, erosion, or both in this lab? Give an example of a step of the lab in which you modeled a process to s

upport your statement. If you say that you did not model one process, describe a way in which you could model that process using the same graham cracker setup.
Biology
1 answer:
kolezko [41]1 year ago
5 0

Modeling of weathering and erosion can be performed in lab.

<h3>Procedure of Modeling Weathering and Erosion using graham cracker:</h3>

1. Fill the ice cube tray or other tiny containers with 100 drops of water in each of the two or three cells using the eyedropper. Make the water entirely solid by freezing it for however long(for 3-4 hrs.).

2. Insert one graham cracker section into the bowl. To create a ramp-like structure out of the Graham Cracker, place one end on the bowl's lip and the other end at the bottom. To secure the cracker to the side of the bowl, dab some icing on the back of the cracker.

3.Add water to the eyedropper. Hold the dropper at a height of about 1 inch above the cracker's top. the dropper over the cracker in the middle. Apply 100 drips, always aiming for the same area.

4.Keep an eye on what the cracker does. Keep a record of your findings.

5. Pour the water into a glass that is clear after removing the Graham cracker. Make notes about the water, grading its cloudiness among your observations.

6.In the same manner as in step 2, clean and dry the bowl and add a Graham cracker to it. Grab an ice cube and wipe it over the graham cracker until it melts completely.

7.Remove the graham cracker and pour the melted water into the clear glass.

<h3>Result:</h3>

Appearance of water collected after is moved across graham cracker.

Learn more about weathering and erosion here:

brainly.com/question/829782

#SPJ10

You might be interested in
What will a hypothesis become if supported by repeated expermentation
soldier1979 [14.2K]
It will become a theory
6 0
3 years ago
Read 2 more answers
Study the diagram. A student on Earth's surface at position A has just seen the sunrise. Which one
Viefleur [7K]

Answer:

B

The second student has not yet seen the same sunrise.

Explanation:

Because as the day goes on, the sunlight shines on places without light as the earth is rotating.

3 0
2 years ago
Read 2 more answers
a change that causes a reaction is a this is for science class please help. use the words to help you and it is question number
zvonat [6]
A change is a response.
7 0
2 years ago
Ferns and moss plants grow from_________?
Vsevolod [243]

Answer:

mosses and ferns plants are two types of primitive plants both plants are non flowering plants

Explanation:

therefore both of them are seedless plant as well both moss and ferns under grow Alternatives of generations

4 0
2 years ago
The following is true about the elbow joint The elbow is made up of the humeroulnar, humeroradial and proximal radioulnar joints
vekshin1

Answer:

**All are Correct**

Explanation:

The elbow is made up of the humeroulnar, humeroradial and proximal radioulnar joints ✔

The elbow flexors are stronger than extensors✔

The MCL is taut during distraction at 90 degrees of elbow flexion✔

The joint capsule resists extension from neutral into hyperextension✔

4 0
3 years ago
Other questions:
  • The sequence of coding strand of a DNA molecule is given below. Assume that it is read from left to right. CCTACCTTATGCCAAGTTGGG
    15·1 answer
  • What role does skin play in the excretory system?
    11·2 answers
  • One way that researchers study the effects of trans fats on people's health is by setting up controlled experiments. For example
    8·1 answer
  • If Earth's atmosphere did NOT contain any water vapor, the temperature of the earth's surface would
    7·2 answers
  • Observation on woodlice
    11·1 answer
  • What are the functions of each type of biological molecule in the bodies of livings things ?
    6·1 answer
  • Viruses are ______ that can only survive and reproduce by infecting living cells.
    5·1 answer
  • Please help ASAP! I have about 30 questions more to answer, so It would be so helpful if you answered this question. Thank you!
    12·2 answers
  • Please help me i will mark brainly
    14·1 answer
  • When the Bicoid protein is expressed in Drosophila, divisions between cells in the embryo are not yet fully developed. This info
    13·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!