1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
yuradex [85]
2 years ago
5

Which of the following are reactants of photosynthesis?

Biology
1 answer:
Valentin [98]2 years ago
7 0
6co2+6h2o + energy , this are the reactants
You might be interested in
4. Type of mutation that involves one of the DNA bases is replace by
Amiraneli [1.4K]

Answer:

Missense

Explanation:

Brainliest please!

7 0
3 years ago
Anxiety, overexcitement, inability to focus, poor coordination, and shaking are common side effects of __________.
Virty [35]
Anxiety, overexcitement, inability to focus, poor coordination, and shaking are common side effects of substance abuse. The class of drugs includes cocaine, nicotine, ecstasy, and amphetamines.However, any drug when used that can cause euphoria or feeling “high”  can become a drug of abuse.
4 0
3 years ago
Read 2 more answers
how do you go throght the life cycle throught metamorphasis and then inside the water cycle preticipating RAIN!!!!
Margaret [11]

Answer:

precipitation, condensation, evaporation, soemthing else, water, clouds, surface ruunoff, etc

Explanation:

hope it helped on science

6 0
2 years ago
Read 2 more answers
Which class of molecules functions as chemical signals?
omeli [17]
A hormone is a molecule that functions as a chemical signal. A hormone is a chemical released by a cell or a gland in one part of the body that sends out messages that affect cells in other parts of the organism. Endocrine hormone molecules are secreted (released) directly into the bloodstream. !
7 0
3 years ago
Read 2 more answers
60 POINTS!!!!!!!!!!!!!!!!!!
GenaCL600 [577]

Answer:

its A

Explanation:

7 0
3 years ago
Read 2 more answers
Other questions:
  • If a cell in g1 has 40 chromosomes, then at the end of meiosis i there will be _________ chromosomes in each daughter cell, and
    11·1 answer
  • A single strand of DNA is ATTCGGCTATTTACGATTGCCAT what is the other strand?
    8·1 answer
  • Protein structures have several different levels of organization. The primary structure of a sequence. The secondary and tertiar
    9·1 answer
  • During the process of ecological secession_____
    11·2 answers
  • How is diffusion related to smelling the odor of a skunk that is far away
    14·1 answer
  • In animals, an individual consisting of diploid cells is usually the life stage that signals to attract a mate and discriminates
    10·1 answer
  • Which of the following is the best description of the events occuring during anaphase I of meiosis?
    6·1 answer
  • Our food supply chain is dependent on the practice of safety at all levels.
    14·1 answer
  • Please help with this tell me what to put for each number pls <3
    14·1 answer
  • Which choice identifies categories of physical characteristics?
    11·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!