5. The petroleum industry uses 1% of the available fresh water in

1 answer:

6 0

Water used by the petroleum industry is injected deep underground and does not return to the hydrological cycle. The correct option is C.

<h3>Water and petroleum industries</h3>

Most of the water used in oil extraction is not returned to the hydrological cycle.

In actual fact, some percentage of the water used in extracting crude oil tends to be a source of pollutants to the freshwater reservoir in the environment.

With irrigation farming, this is not the case. Thus, many citizens will oppose the use of water by the petroleum industry but not irrigation farming.

More on the petroleum industries can be found here: brainly.com/question/25396009

#SPJ1

You might be interested in

BLAST (Basic Local Alignment Search Tool) is a powerful tool for comparing unknown sequences to sequences in online databases. I

storchak [24]

Answer:

This is a well conserved sequence.

Explanation: BLAST a way to match or align a string of DNA or protein sequence to those that are already in a database. The way that this is done is by using statistics carefully to calculate the significance of the match. The BLAST result will produce 4 categories Max Score, Total Score, Query cover, E-Value Percent Identity. The Accession will indicate database of the sequence. In this Sequence: AAGACCCGCCGGGAGGCAGAGGACCTGCAGGGTGAGCCAACCGCCCATTGCT covers over 98.08% identity to the coding sequence (cds) of insulin. This sequence appears to be in a conserved region for many of the listed organism. This suggest that this part of the coding sequence for this protein is highly conserved