1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
swat32
2 years ago
11

What is one likely reason for why a gram-stain staphylococcus epidermidis would appear pink under the microscope? why might esch

erichia coli look purple?
Biology
1 answer:
k0ka [10]2 years ago
6 0

In gram strain staphylococcus appears pink because the presence of thick layer of peptidoglycon in their cell walls, which retains the crystal violet these cells are stained with.

If the color of bacteria was purple it  means gram positive infection is present but if it appears pink and red then it means gram negative infection is present.Gram stain which is also known as gram's method , is used to classify bacterial species into two groups - gram negative bacteria and gram positive bacteria.

These  names found by bacteriologist has christian gram.Most of the proteins is the cytoplasm are normal, so eosin binds to these proteins and stains them pink.

To learn more about gram strain staphylococcus here

brainly.com/question/6067833

#SPJ4

You might be interested in
All animals need to eat ? To get? To live
Sonbull [250]
Yea all animals need to eat so they could live and survive
6 0
3 years ago
Read 2 more answers
The leader of the skirmish against Chitto Harjo and other resistance leaders was US Marshal __________
Sidana [21]
U.S. Marshal Leo Bennett was the leader of the Skirmish against Chitto Harjo and other resistance leaders . When delegations of Snakes started seizing property and whipping tribe members who supported allotment, the Creek National Council turned to U.S. Marshal Leo Bennet to arrest Harjo and his followers. 
5 0
3 years ago
A Person roller skates down a street heading east. Which of the following would be true about friction in this scenario?
hammer [34]
D. friction pulls the skates wheels westward 
8 0
3 years ago
ASAP..I will give BRAINIALIST!! Describe how oxygen and hydrogen form water.
Ket [755]

Answer:

When molecular hydrogen (H2) and oxygen (O2) are combined and allowed to react together, energy is released and the molecules of hydrogen and oxygen can combine to form either water or hydrogen peroxide. In this oxidation, a molecule of hydrogen gas is ionized to two electrons and two protons

6 0
3 years ago
1. Which event describes a change where evolution has happened?
serg [7]
First one is C, second one is B, third one is C
5 0
3 years ago
Other questions:
  • This is any multicellular living thing that obtains energy from sunlight or makes its own food
    7·2 answers
  • HELPPP
    10·2 answers
  • (1 pt) Why is DNA called the blueprint for life? A. It has the code to make carbohydrates. B. It stands for Director of New Acti
    9·2 answers
  • The nine different classes of vertebrates include
    13·1 answer
  • Which of the following accurately describes HIV?
    5·2 answers
  • What's a photo of carbohydrates, lipids, nucleic acids, and proteins look like?​
    11·1 answer
  • How many species of fungi is there
    8·2 answers
  • The tRNA for GUCAUCGAUCGAUCGGAUGCC
    11·1 answer
  • What structure regulates the movement of food from the stomach to the small intestine? it connects the mouth to the stomach..
    13·2 answers
  • The motor neuron and all the myofibers it innervates is referred to as a ____________ . every time a motor neuron sends a nerve
    11·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!