1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
serious [3.7K]
1 year ago
8

What is BMPER? Did its discovery come from basic or applied science? Explain your reasoning fully. 20 POINTS!!!!

Biology
1 answer:
Maru [420]1 year ago
8 0

BMPER serves as   a protein which is found in  humans and it is been encoded by the BMPER gene.

Yes, the discovery come from basic or applied science  because  the discovery as a result of observation through research and can be proven  with evidence which is what science is based on.

<h3>What is BMPER?</h3>

Bone morphogenetic proteins (BMPs) can be described as one that is found in  embryonic and adult blood vessel formation  which is been used in  health .

BMPER  serves as a  differentially expressed protein  that can be found in the  embryonic endothelial precursor cells.

It should be noted that  BMPER can carry out some  interactions with BMPs, and in the case whereby  they were overexpressed , they will antagonizes their function in embryonic axis formation.

Therefore, BMPER serves as   a protein which is found in  humans and it is been encoded by the  BMPER gene.

Read more about  BMPER gene here:

brainly.com/question/1480756

#SPJ1

You might be interested in
If a th reads this, or if destinyawakens goes on this question can u help me, if its anyone else besides him. dont answer this.
Anon25 [30]
<span>The Cerebrum: The cerebrum or cortex is the largest part of the human brain, associated with higher brain function such as thought and action. The cerebral cortex is divided into four sections, called "lobes": the frontal lobe, parietal lobe, occipital lobe, and temporal lobe.</span>
7 0
3 years ago
Read 2 more answers
Explain the difference between somatic cells and gametes
Marizza181 [45]

Answer:

somatic:any cell of a living organism other than the reproductive cells.

gametes:a mature haploid male or female germ cell which is able to unite with another of the opposite sex in sexual reproduction to form a zygote.

Explanation:

5 0
3 years ago
Which type of asexual reproduction involves duplication of the parent DNA before dividing itself into two?
Kipish [7]

Answer:

binary fission - asexual reproduction by a separation of the body into two new bodies. In the process of binary fission, an organism duplicates its genetic material, or deoxyribonucleic acid (DNA), and then divides into two parts (cytokinesis), with each new organism receiving one copy of DNA.

7 0
3 years ago
Assembling a complete sequence from fragment sequences
Soloha48 [4]

Answer:

"GATGACATGGCGTCAGTCGATGCG" is the complete DNA sequence having 24 bases.

Explanation:

The shotgun sequencing is the process that is being used haphazard DNA strands arrangement. The nomenclature is given by the correspondence as it is growing rapidly. The pattern of firing is quasi accidental. In the preparation of DNA strands like 100 to 1000 base pairs, the chain alteration process is used. It can haphazardly break any DNA arrangement into many small pieces,and then can make copies that are completely identical to it.

7 0
3 years ago
Binary fission is cell division in prokaryotic organisms (bacteria), which have no nucleus. In addition, prokaryotic cells typic
lilavasa [31]

Explanation:

  • Binary fission is simple ad rapid compared to mitosis that involves complexities like breaking down the nuclear membrane – which prokaryotes do not have – and replicating the many chromosomes – when prokaryotes have only one.
  • Replication of the circular DNA in prokaryotes happens as the process of division of the cell happens. In mitosis, the replication of all the genetic material must finish before the process of cytokinesis begins.
  • Spindle fibers are not formed in binary fission while they are significant in mitosis in drawing different chromosomes to different poles of the cell before cytokinesis.

6 0
3 years ago
Other questions:
  • When does recycling happen in the mineral resource cycle?
    15·2 answers
  • Fossils show how the complexity of living organisms has changed over time. Gerobatrachus hottoni was a unique organism that live
    9·1 answer
  • 3. What do you notice about the negatively charged atom of one atom in one molecule and the positively
    7·1 answer
  • 10 POINTS PLLZZZ HELP!!URGENT
    10·1 answer
  • How does natural selection lead to evolution
    11·1 answer
  • How does stress affect a person's genetics and DNA? (answer in paragraph form -- at least 8 sentences)
    5·1 answer
  • Hydrosphere Part 1 / 34 of 46
    5·2 answers
  • 2. What is a feature of transcription? * 1 point Both strands of a DNA molecule act as a template for mRNA. Nucleoside triphosph
    13·1 answer
  • In your psychology class, you learned about the famous case in which railroad worker Phineas Gage suffered a severe head injury.
    13·1 answer
  • What is biological abundance - BRAINLIEST IF RIGHT
    10·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!