1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
spin [16.1K]
1 year ago
10

Question 4 (1 point)

Biology
1 answer:
Wewaii [24]1 year ago
5 0

Answer:

c) acidosis a higher carbon dioxide level

with alkalosis lower carbon dioxide

You might be interested in
A structure that helps prevent food from entering the pharynx prematurely is the
nadezda [96]

Answer:

Uvula

Explanation:

The uvula is a fleshy structure found at the back of the soft palate in the mouth. It is the structure seen hanging at the back of the throat when someone opens his/her mouth and views in the mirror.

<em>The uvula is made up of flexible tissues with the ability to produce saliva. During eating or swallowing of food, the uvula along with the soft palate move to seal off the pharynx in order to prevent food materials from entering the nasal passage.</em>

8 0
3 years ago
Read 2 more answers
*picture added*<br> does anyone know?
Sedaia [141]
I’m pretty sure it’s shale.
6 0
3 years ago
Hair color is a trait that’s controlled by many genes working together. Each gene contributes to this trait only in a small prop
omeli [17]

Answer:

tbh i think its D

Explanation:

i say its D cos why not and i dont have enough brain cells for this

3 0
3 years ago
Read 2 more answers
Help me with these questions
ANTONII [103]
The object is about to go/going down a hill, its increasing. b

5 0
4 years ago
Read 2 more answers
What are permanent tissues
Rufina [12.5K]
Permanent tissue is composed of cells that have lost the ability to divide and has attained a definite shape or form. There are three main types of permanent tissue. 1) simple, 2)complex, 3) special tissues.
5 0
3 years ago
Read 2 more answers
Other questions:
  • A woman who is a carrier for colour blindness (X-linked recessive) has children with a man who has normal colour vision. A. What
    9·1 answer
  • Why did George Mendel choose to use purebred plants in his experiments
    6·1 answer
  • What is a diploid chromosome?
    7·1 answer
  • The process of copying a gene's dna sequence into a sequence of rna is called what?
    7·2 answers
  • Consider the number of males who were diagnosed with melanoma in 2005. What quantity does this number represent?
    8·2 answers
  • Which of these is NOT an option to help increase sustainability?
    11·1 answer
  • PLZ HELP URGENT. WILL GIVE BRAINLIEST!!!!!
    11·1 answer
  • What would be the complementary strand for the following DNA sequence 5' GACATACCCAGACGGTATATTGA 3'
    8·1 answer
  • "Why do eukaryotes generate only about 36 ATP per glucose in aerobic respiration but prokaryotes may generate about 38 ATP
    12·1 answer
  • What is the role of RNA polymerase?
    10·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!