1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Vladimir [108]
3 years ago
12

What is the organism that is harmed in the parasitism called ?

Biology
2 answers:
Roman55 [17]3 years ago
5 0
The correct answer is:  [B]:  "host" .
________________________________________________
prohojiy [21]3 years ago
4 0
Hi there!!

The answer is definitely B. Host

Hope I helped you:)

~TRUE BOSS
You might be interested in
An increase in earths temperature from the build up of carbon dioxide and other gases in the atmosphere is called... global warm
natima [27]

Answer:

i think

Explanation:

3 0
3 years ago
Why does an insertion mutation usually cause more defects during protein synthesis than a point mutation?
navik [9.2K]
 protien can be effected bc there are certain acids in your body and if u add more mutation then it messes with all the acid and stuff in your body and can be very harmful 
4 0
4 years ago
Read 2 more answers
What is the answer to this?
lora16 [44]

Answer:

I say the correct answer is the 3rd one.

Explanation:

Answer is number 3

3 0
3 years ago
Describe the three main properties of a population​
Tamiku [17]

Population refers to an array of organisms of the similar species, which thrives in a particular geographical region and interbreed. The three main characteristics of a population are density, size, and dispersion.  

The density signifies towards how many organisms are thriving in a specific region. The size refers to how big a population is, and dispersion signifies towards the degree of spreading of the particular population.  

4 0
3 years ago
The genetic material housed inside the cell nucleus is packaged into these organized bundles.
JulsSmile [24]

the genetic material housed inside the cell nucleus is packaged in into these organized bundles.

- chromosomes

5 0
3 years ago
Read 2 more answers
Other questions:
  • A population distribution shows _______
    11·1 answer
  • In eukaryotes, glycolysis typically occurs in the _____, gluconeogenesis typically occurs in the _____
    5·1 answer
  • evaluate whether having sickle cell disease would be advantageous or disadvantageous to a person living in central africa
    13·1 answer
  • Which of the following is not true of a scientific theory?
    7·2 answers
  • List the nitrogen bases that would form the complementary strand: TTCTACCCTACATAGACTCAT
    14·1 answer
  • Please select the word from the list that best fits the definition
    10·2 answers
  • Las flores son abioticas o bioticas​
    13·1 answer
  • Name the main chemical responsible for pollen tube growth
    11·2 answers
  • You are a molecule of carbon. Choose a starting
    15·1 answer
  • Use the information in the chart to determine if it describes a living object. composed of cells complex chemical activities com
    14·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!