1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
maksim [4K]
1 year ago
10

What are the 5 stages of mitosis and what happens in each stage?.

Biology
1 answer:
bekas [8.4K]1 year ago
4 0

There are five phases: prophase, prometaphase, metaphase, anaphase, and telophase. Final physical cell division after telophase, cytokinesis is frequently regarded as the sixth stage of mitosis with Centrosomes.

1. Mitosis begins with the prophase.

Chromosomes gather and are made visible.

Centrosomes are the origin of spindle fibres.

Nucleolus dissolves as nuclear envelope disintegrates.

2. Second stage of mitosis known as prometaphase.

Chromosomes continue to compact.

At the centromeres, kinetochores are visible.

Centrosomes travel in the direction of their opposite poles as mitotic spindle microtubules attach to kinetochores.

3. Metaphase is the third mitotic division.

The mitotic spindle has reached its full size, the centrosomes are at the poles of the cell, and the chromosomes are aligned at the metaphase plate. Each sister chromatid is attached to a spindle fibre that originates from the opposing poles. In the middle is each chromosome.

4. Anaphase is the fourth stage of mitosis.

Previously joined together by cohesin proteins, sister chromatids (now known as chromosomes) split and are drawn in opposing directions.

Non-kinetochore spindle fibres lengthen as the cell does.

5. The fifth stage of mitosis is called telophase.

The nuclear envelope material that surrounds each set of chromosomes decondenses as the chromosomes arrive at opposite poles.

6. The sixth and last stage of mitosis is cytokinesis.

Animal cells: the daughter cells are divided by a cleavage furrow.

A cell plate separates the daughter cells in plant cells.

the splitting of the cytoplasm into the two distinct daughter cells.

Learn more about mitosis

brainly.com/question/26678449

#SPJ4

You might be interested in
Pathogens transmitted by means of cuts or punctures are an example of _______ transmission.
kupik [55]

Answer:

Parenteral Transmission

6 0
1 year ago
The Hawaiian Islands are home to many endangered species. Why do you think the Hawaii Department of Agriculture is so strict abo
zysi [14]
Because these non native species can cause competition for the same food source as the native species thus making it harder for the native species to survive. Also the non native species could see the native species as food causing them to die out. As well as introducing new diseases that these native species don’t know how to defend themselves from
4 0
3 years ago
Which term can apply to a molecule composed of two or more different elements?
Scilla [17]

Answer:

d

Explanation:

6 0
3 years ago
What is the mRNA sequence to match the DNA sequence below:<br><br> TACGCTCCATATCGCTAATCGCCGGATCAGATT
Kazeer [188]
AUGCGAGGUAUAGCGAUUAGCGGCCUAGUCUAA because A goes to U; T goes to A; G goes to C; C goes to G.
8 0
2 years ago
Read 2 more answers
Function of the plant cell wall?
bekas [8.4K]
<span>The function of a cell wall has the same function of the cell membrane; it protects the cell. Cell wall is made up of cellulose that is only present in plant cells. Cellulose is a sugar that has a sheet like structural carbohydrate. It is rigid that is used for support and provides protection to the plant cell from damage. They cannot be dissolved in water. An example is if you eat food that contains mostly of leaves. You will observe that you will eliminate the same material as when you it. That is because our human body does not have the enzyme that dissolves the cellulose.</span>
7 0
3 years ago
Other questions:
  • Cancer is the product of a mutation that
    9·1 answer
  • What is LDL cholesterol? Explain in details.
    10·1 answer
  • Use the Internet to research a specific case where radiometric dating was instrumental in a significant archeological discovery.
    10·1 answer
  • When two parental generation of a rose are crossed what term is given to the resulting generation
    11·1 answer
  • Which statement correctly describes what proteins, lipids, and glycogen have in common? a. They are all used as primary energy s
    15·2 answers
  • PLEASE HELP! Biology Unit Test!
    7·1 answer
  • Based on the pedigree that is shown, which describes John? carrier for hemophilia expresses hemophilia does not have hemophilia
    10·2 answers
  • How many amino acids will be made from a mRNA strand that has 18 bases?
    12·2 answers
  • PEASE HELP. What are the two main sources of energy on earth? Explain some things that each source creates/powers/ does for eart
    11·1 answer
  • 4. All of the following are considered carbohydrates except ....
    7·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!