1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
34kurt
1 year ago
14

Can I find a tutor to help me with this question?

Chemistry
1 answer:
Eddi Din [679]1 year ago
8 0

INFORMATION:

We have the following statements

And we must complete them

STEP BY STEP EXPLANATION:

To complete the statements, we need to classify matter according to its state:

- Solid:

there is not enough thermal energy to overcome the intermolecular interactions between the particles. As a result, solids have a definite shape and volume.

- Liquid:

That describes the liquid state. In a liquid, the particles are still in close contact, so liquids have a definite volume. However, because the particles can move about each other rather freely, a liquid has no definite shape and takes a shape dictated by its container.

- Gas:

That describes the gas state, which we will consider in more detail elsewhere. Like liquids, gases have no definite shape, but unlike solids and liquids, gases have no definite volume either.

Finally, we know that:

- A solid has a definite volume and has a definite shape

- A liquid has a definite volume and has not a definite shape

- A gas has not a definite volume and has not a definite shape

ANSWER:

- A solid has a definite volume and has a definite shape

- A liquid has a definite volume and has not a definite shape

- A gas has not a definite volume and has not a definite shape

You might be interested in
Help pls you get 22 points if you answer me
snow_tiger [21]

Answer:

the 2nd one

Explanation:

All other symbols are for Mathematics.

5 0
2 years ago
Compared to ultraviolet light, an electromagnetic wave that has a higher frequency will also have ________.
Nikitich [7]
  • The answer is shorter wavelength and equal speed.                        

That is, compared to ultraviolet light, an electromagnetic wave that has a higher frequency will also have shorter wavelength and equal speed.

This can be seen by the reaction given below:

 h\times \upsilon =\frac{c}{\lambda }

h= Planck's constant

c=speed of the light

 \upsilon=frquency

{\lambda }=wavelength

So, higher is the frequency, lesser is the volume while speed remains constant as c is speed of light.

6 0
3 years ago
Read 2 more answers
After reading a book about parrots, Tani wants to learn more about them. Which question could be answered through scientific inv
FrozenT [24]

After reading a book about parrots, Tani wants to learn more about them. The question that could be answered through scientific investigation is letter B, ‘<span>What substances make up an eggshell?’ The other choices cannot be answered through scientific investigation.</span>

8 0
2 years ago
In a particular breed of cattle, a black coat is dominant over a red coat. If a cow with a red coat is crossed with a black bull
larisa86 [58]
C.75%. Because the B is dominant 
3 0
3 years ago
Hydrofluoric acid is what type of acid?
posledela

Hydrofluoric acid is a solution of hydrogen fluoride (HF) in water. Solutions of HF are colourless, acidic and highly corrosive. It is used to make most fluorine-containing compounds; examples include the commonly used pharmaceutical antidepressant medication fluoxetine (Prozac) and the material PTFE (Teflon).

5 0
2 years ago
Other questions:
  • What is the molar mass of 81.50g of gas exerting a pressure of 1.75atm on the walls of a 4.92L container at 307K?
    9·2 answers
  • How many kilograms of the rock must be processed to obtain 2.0 kg of Pb ?
    8·1 answer
  • The IR spectrum of a solid can be taken by dissolving it to create a solution. An appropriate solvent is Choose... because its I
    5·1 answer
  • Why is granite speckled
    10·2 answers
  • PLEASE ANSWER<br><br> A. Point B and D<br> B. Point D and E<br> C. Point C only<br> D. Point A and B
    10·1 answer
  • If you are given ethanol (C8H18) 6.3lbs/ gal and you have 12 gallons how many moles do you have? 
    7·1 answer
  • Which ocean surrounds Antarctica at the South Pole?
    10·2 answers
  • Write the pair sequence using the right base for the mouse DNA. ATGGGTGATGTTGAAAAAGGCAAGAAGATTTTTGTTCAGAAGTGTGCCCAGTGCCACACT
    5·1 answer
  • Ned help with this question​
    15·1 answer
  • What is the significance of the spin quantum number.
    8·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!