1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
kondor19780726 [428]
1 year ago
7

the rapid depolarization phase of the action potentials of myocardial contractile cells is due to which ion(s)?

Biology
1 answer:
Oduvanchick [21]1 year ago
5 0

The rapid depolarization phase of the action potentials of myocardial contractile cells is due to Na⁺ ion.

The depolarization is caused when Na⁺ ions rapidly enters into neuron through open sodium channels. Sodium ions plays important role in various physiological process such as regulating blood volume, ph regulation,  maintaining blood pressure, energy metabolism,osmotic equilibrium, excitation-contraction coupling, maintenance of cellular homeostasis, development and growth.

brainly.com/question/6639857

#SPJ4

You might be interested in
PLS HELP ME WITH THIS!!!<br><br> What is the nucleotide sequence of the mRNA strand you built?
Ad libitum [116K]

Answer:

A DNA strand contains the following nucleotide sequence: TACTGCCTCCCCATAAGAATT

Explanation:

5 0
3 years ago
Read 2 more answers
Brown coat color in rabbits is dominant and white is recessive. Th allele for short fur is dominant, the allele for long fur is
Zarrin [17]

Yes because the dominant genes would cover up the recessive ones

4 0
3 years ago
How can you the sex of the individual from the karyotype? ​
Sergeeva-Olga [200]

Answer:

There are 22 numbered pairs of chromosomes called autosomes. The 23rd pair of chromosomes are the sex chromosomes. They determine an individual's sex. Females have two X chromosomes, and males have an X and a Y chromosome.

This is how you know if a karyotype is male or female?

4 0
3 years ago
Read 2 more answers
Resource partitioning is best described by which of the following statements? A) Competitive exclusion results in the success of
FinnZ [79.3K]

Answer:

B

Explanation:

3 0
3 years ago
What is molecule x
nignag [31]

If I'm not mistaken, that would be what is known as a peripheral protein. Peripheral proteins are proteins which are either inside or outside the cell membrane, but don't cross it.

If a protein crosses the cell membrane, it'll be called an integral protein.



Hope it helped,



BioTeacher101

3 0
3 years ago
Other questions:
  • Which layer of the sun is only seen during a total solar eclispe?
    8·2 answers
  • Nitrogen compounds are often used as fertilizers to increase plant growth.
    9·1 answer
  • What are Eukaryotes?
    9·1 answer
  • 3. RNA contains which of the following bases:
    11·1 answer
  • Viruses are considered non-living organisms because:
    15·1 answer
  • A cell with six chromosomes undergoes mitosis how many chromosomes does each daughter cell have
    5·2 answers
  • At the complete end of cellular respiration, how many molecules of ATP are produced?
    12·1 answer
  • Mimicry or camouflage ?
    13·2 answers
  • Natural erosion can be caused by _______.
    5·2 answers
  • Why do the polypeptides made in prokaryotes always contain formyl methionine as the first amino acid?
    15·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!