Answer:
A DNA strand contains the following nucleotide sequence: TACTGCCTCCCCATAAGAATT
Explanation:
Yes because the dominant genes would cover up the recessive ones
Answer:
There are 22 numbered pairs of chromosomes called autosomes. The 23rd pair of chromosomes are the sex chromosomes. They determine an individual's sex. Females have two X chromosomes, and males have an X and a Y chromosome.
This is how you know if a karyotype is male or female?
If I'm not mistaken, that would be what is known as a peripheral protein. Peripheral proteins are proteins which are either inside or outside the cell membrane, but don't cross it.
If a protein crosses the cell membrane, it'll be called an integral protein.
Hope it helped,
BioTeacher101