1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Orlov [11]
3 years ago
10

What is the probability that an offspring will have SsRr genotype from a cross of SsRr individuals

Biology
1 answer:
lara [203]3 years ago
4 0

Answer:

6.26%

Explanation:

You might be interested in
A biologist looks at an organism through a microscope.
faust18 [17]

Answer:

B

Explanation:

It has membrane-bound organelles. Mitochondria and chloroplasts are structures found in the eukaryotic cells.

8 0
2 years ago
Which of the following is true concerning mangrove forests?
MAXImum [283]

Answer:

c.

Mangrove forests are named for the mangrove tree.

Explanation:

Salt Marshes and Mangroves

Edge 2020

4 0
3 years ago
Read 2 more answers
A certain segment of DNA can be used as a molecular clock. Its rate of mutation is one mutation per 20 million years. Examine th
IgorC [24]
Let's calculate the difference in nucleotides. The number of difference multiplied by rate of mutations will help to determine how long ago these two species shared a common ancestor.

Species A: GTACCTAAGTTCACCGAATT
Species B: GAACCTAAGGGCACCGAACT

These species differ in 4 nucleotides.
This number should be multiplied <span>by </span>the rate of mutations
5 0
2 years ago
6. Which of the following is NOT an environmental benefit of plants?
Svetllana [295]

Answer:

the answer is increase erosion

Explanation:

Plants do not increase erosion instead they reduce it

3 0
3 years ago
Choose all the answers that apply.
SashulF [63]
Deltas and sand dunes form from erosion
 
<span>a river carrying dirt into a lake is a example of water erosion
</span>
fossils can tell us about environments

when the oceanic and continental plate collide, the oceanic plate sinks below the continental plate

a footprint is a trace fossil 



<span />
8 0
2 years ago
Read 2 more answers
Other questions:
  • In a controlled experiment, why must all of the variables, except one, be kept constant throughout the experiment
    5·1 answer
  • Pls help me answer this question and pls put an explanation!!!!
    12·1 answer
  • Design a method to separate a mixture of<br> sugar, sand, and bits of iron.
    14·1 answer
  • A loopful of bacteria containing 1000 bacterial cells is inoculated into a nutrient broth and incubated. After a negligible lag
    12·1 answer
  • In three (3) sentences, explain the function of a vacuole in plant cells
    7·2 answers
  • The diffusion of _______ through cell membranes is called osmosis.
    15·1 answer
  • A car traveling at 15 m/s starts to decelerate steadily. It comes to a complete stop in 10 seconds. what is its acceleration ?
    12·1 answer
  • the appendages of cockroaches and turtles are modified for creeping movements,but their internal structures are completely diffe
    14·2 answers
  • True or False? The filtrate - the material that is filtered from the blood - contains
    8·1 answer
  • Which was Venter’s contribution to science?
    7·2 answers
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!