1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Bogdan [553]
3 years ago
14

What do you mean by chemical reaction ?​

Chemistry
1 answer:
kherson [118]3 years ago
6 0

A chemical reaction is a reaction that changes the molecular structure and is normally irreversible.

You might be interested in
An aqueous solution of potassium sulfate (K2SO4) has a freezing point of -2.24
iragen [17]
An aqueous solution of potassium sulfate exhibits colligative properties. Colligative properties are properties that depends on the concentration of a substance in a solution. These properties are freezing point depression, vapor pressure lowering, osmotic pressure and boiling point elevation. For this problem we use the concept of freezing point depression since we are given the freezing point of the solution. Freezing point depression is as:
 
ΔT = -k(f) x m x i
-2.24 - 0 = -1.86 x m x 3
<span>m = 0.4014

Thus, the molality of the solution is 0.4014.</span>
7 0
3 years ago
0.080 mole ba, 0.080 mole s, and 0.320 mole o
Andre45 [30]
Ewdrqw3ecdr4qwe4rfwqefq343rfqweftrweqf
5 0
3 years ago
True or false: Nonmetals are good conductors of electricity?
Ostrovityanka [42]

Answer:

False

They dont conduct electricity that well/at all

8 0
2 years ago
Read 2 more answers
Which will contain the greater number of moles of potassium ion: 30.0 ml of 0.15 m k2cro4 or 25.0 ml of 0.080 m k3po4?
Dahasolnce [82]
<span>30.0 ml of 0.15 m K2CrO4 solution will have more potassium ions. Let's see the relative number of potassium ions for each solution. Since all the measurements are the same, the real difference is the K2CrO4 will only have 2 potassium ions per molecule while the K3PO4 solution will have 3 potassium ions per molecule. K2CrO4 solution 30.0 * 0.15 * 2 = 9 K3PO4 solution 25.0 * 0.080 * 3 = 6 Since 9 is greater than 6, the K2CrO4 solution will have more potassium ions.</span>
3 0
3 years ago
What is considered to be a physical property of matter
katrin [286]

Answer: Some examples are color, density, volume and mass

Explanation:

Physical properties are anything you can smell, touch, or hear. They can be observed without changing.

8 0
3 years ago
Other questions:
  • A roller coaster reaches its maximum potential energy when it
    12·1 answer
  • What is the approximate pH of a .06 M solution of CH3COOH given that Ka= 1.78*10-5
    12·1 answer
  • Le Châtelier’s principle states that increasing temperature favors a reaction that a. releases energy as heat. c. involves a che
    12·2 answers
  • A . When atoms share electrons to fill their outermost energy levels, they form _________ bonds.
    7·1 answer
  • The radii of the sodium and potassium ions are 102 pm and 138 pm, respectively. which compound has stronger ionic at- tractions,
    15·1 answer
  • Can colloidal suspensions be separated out by filtration
    11·2 answers
  • What is the conjugate acid in the forward reaction?
    5·1 answer
  • Nuclear energy is currently used in which three kinds of vehicles? O cars, submarines, spacecraft submarines, ships, spacecraft
    5·1 answer
  • Describe how to prepare 2.00 L of a 0.25 M aqueous KNO3 solution
    5·1 answer
  • Write the pair sequence using the right base for the mouse DNA. ATGGGTGATGTTGAAAAAGGCAAGAAGATTTTTGTTCAGAAGTGTGCCCAGTGCCACACT
    5·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!