1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
bagirrra123 [75]
3 years ago
5

Which two species are more closely related: Ursus maritimus, ursus americanus or bufo americanus

Biology
2 answers:
Ann [662]3 years ago
7 0
<span>americanus refers to location where the species is found.

</span><span>Ursus maritimus (polar bear) and ursus americanus (black bear) are closely related.</span>
GarryVolchara [31]3 years ago
5 0
I think that is bufo americanus.
You might be interested in
The most complex organic<br> compounds are the_____.
Mars2501 [29]

Answer:

i-propyl cyanide

Explanation:

But i-propyl cyanide is the largest and most complex organic molecule found to date - and the only one to share the branched atomic backbone of amino acids. "The idea is to know whether the elements that are necessary for life to occur… can be found in other places in our galaxy."

6 0
3 years ago
Compare the organisms in the table. what plantlike characteristic does a methanogen share with organisms in the kingdom plantae?
ikadub [295]
Plantlike and methanogen organisms share som similar characteristics, for instance, can both produce their own and can process their made food into energy for different cellular processes such as cell division, repair and maintenance.

Despite this similarity though, the difference lies with the source of energy that get to produce the food. Plantlike organisms use sunlight and UV rays to photosynthesize. Whereas, methanogens use methane where sunlight is not present.
6 0
3 years ago
Read 2 more answers
What is the mechanism of natural selection?
borishaifa [10]
The answer is D. The natural selection is a theory which illustrates the gradual process of evolution in the population due to the change of environment. The key point is the mutation (variation) exists in the population before the environment changing. For C, if the environment does not change, though the adaptation is useful to environment, it will not be selected. Because the organisms without the adaptation will not die.
8 0
3 years ago
True or false? Pure water is tasteless.
astra-53 [7]
True water from nature has no taste
6 0
3 years ago
Read 2 more answers
Please help!!!!!!!!!!
V125BC [204]
The answer would be B
8 0
3 years ago
Other questions:
  • A satellite in a 24-hour circular orbit with non-zero tilt angle (slight tilt away from the equatorial plane of Earth) will appe
    12·1 answer
  • (HELP!) Look at the Punnett square obtained by the monohybrid cross between two rabbits. 
    7·1 answer
  • The nurse applies a bandage to a patients hand. what should the nurse assess
    12·1 answer
  • Which of the following is a substance that acts at a long distance from the site at which it is secreted? View Available Hint(s)
    8·1 answer
  • What is a short run?
    6·1 answer
  • Draw an mrna strand that is complementary to the dna strand aattgc. circle a nucleotide
    15·1 answer
  • A student wants to test the effect of nitrogen rich fertilizers on the growth of rose bushes. Which of the following is a variab
    5·1 answer
  • One measure of weather includes the maximum distance at which large objects can be seen and identified with the unaided eye. wha
    13·2 answers
  • Say you had the following DNA sequence: ATGCTGCGAAACTTTGGCTGA Let's say there was a mutation that removed one letter (the first
    5·1 answer
  • What is the chemical equation that represents cellular respiration and what organelle it takes place in
    9·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!